Sol_Doc.pdf

Solicitation No: FDA-22-SOL-1240447 Microbiology of FDA Regulated Foods, Agricultural Water, and Cosmetics

Food and Drug Administration (FDA)

FDA Center for Food Safety and Nutrition (CFSAN)

Indefinite Delivery Indefinite Quantity (IDIQ)

Issue Date: January 31, 2022

NAICS Code: 541380 – Testing Laboratories

1. MICROBIOLOGY OF FDA REGULATED FOODS, AGRICULTURAL WATER,

AND COSMETICS

1.1 BACKGROUND

Ready-to-eat (RTE) foods can be vehicles for foodborne outbreaks involving foodborne pathogens such as Salmonella, Listeria monocytogenes, Shiga-toxin producing Escherichia coli (STEC), etc. Foods that are especially prone to outbreaks include those that are consumed raw and have undergone little or no processing. Examples of these foods include raw fruits and vegetables, salads, raw nuts, spices, smoked fish, and soft cheeses made from unpasteurized milk. The fact that consumers are encouraged to eat raw foods like fruits and vegetables underscores the need to keep these foods safe and wholesome, as well to assure that they are adequately monitored for safety. Increases in the worldwide consumption of RTE produce, such as lettuce and spinach, have resulted in increases in foodborne illness associated with these products. In the U.S. in 2006, a multistate outbreak of Escherichia coli 0157:H7 was traced to bagged spinach. A few months later, another outbreak implicated bagged lettuce in fast food restaurants, thus raising concerns about the microbiological quality of RTE produce.

In addition to RTE leafy greens, sprouts, spices, and fresh fruit have also been sources of foodborne illness. In 2011, an E. coli O140:H4 in fenugreek sprouts sickened 3,000 and killed

45 victims. This outbreak originated in Germany and spread to 16 other nations, including the

United States where it resulted in 1 death and 4 cases of hemorrhagic uremic syndrome. In

2011, there were several sprout recalls due to Salmonella contamination, though none of these apparently resulted in illness or death. The German STEC outbreak and the Salmonella recalls serve as sentinel events demonstrating the vulnerability of sprouts to foodborne outbreaks. In

2008, Salmonella Saintpaul in jalapeno and Serrano peppers sickened 1500 people over 43 states. In 2008/2009, Salmonella Rissen in white pepper, killed 1 and sickened an additional

200 victims over 5 states. Fresh fruit have also been vehicles for foodborne outbreaks. In 2011, Salmonella contaminated papayas were responsible for 97 reported illnesses over 23 states and

Listeria monocytogenes in cantaloupes killed 30 and sickened 146 victims over 28 states. In

2017, there were 3 separate outbreaks of Salmonella associated with papayas. Overall, approximately 400 people are killed in the United States annually by Salmonella infections

(CDC, 2010), with 31% of all food related deaths in 2005 being attributed to Salmonella infections (CDC, 2005).

FDA have conducted surveys on microbiological safety of selected produce (spinach, lettuce, cantaloupe, cucumber, mongo and sprouts), spices (cumin seed, sesame seed, white pepper, basil leaf, black pepper, coriander seed, curry powder, dehydrated garlic, oregano leaf, paprika, red pepper), and tree nuts (cashews, pecans, hazelnuts, macadamia nuts, pine nuts, and walnuts) in the last few years (Zhang et al., 2017; Zhang et al., 2018; Zhang et al., 2021).

A total of 14,183 leafy greens, 2,652 sprouts, and 3,411 melons samples were collected throughout the United States during 2010 - 2014. The samples were analyzed for aerobic plate counts (APC), total coliform counts (TCC), generic Escherichia coli counts (ECC), Salmonella, Shigella, Listeria monocytogenes, and Shiga toxin-producing E. coli (STEC), depending on the year and type of produce. Among leafy green samples, no E. coli O157:H7 or non-O157 STEC were detected from iceberg lettuce samples. The overall prevalence of

Salmonella, E. coli O157:H7, non-O157 STEC, and L. monocytogenes in the 14,183 leafy green samples studied were 0.05, 0.01, 0.07, and 0.11%, respectively. Among sprout samples, no Salmonella or E. coli O157:H7 were detected; the overall prevalence of non-O157 STEC and L. monocytogenes in the sprout samples were 0.04 and 0.11%, respectively. Among melon samples, no Salmonella was detected from cucumbers; no L. monocytogenes was detected from cantaloupes; the overall prevalence of Salmonella and L. monocytogenes in melons samples tested were 0.12 and 0.23%, respectively. L. monocytogenes levels ranged from 0.4 to 1,470

MPN/g in leafy greens; 0.36 to 1,100 MPN/g in sprouts; < 0.03 to 150 MPN/g in melons

(Zhang et al., 2018).

Samples of various spice types were collected from November 2013 to March 2015 throughout the country by a FDA contractor. No Salmonella-positive samples were found among retail samples of cumin seed (whole/ground), sesame seed (whole, not roasted/toasted, not black), and white pepper (ground/cracked). Salmonella prevalence estimates and confidence intervals for the other eight spice types were: 0.19% for basil leaf

(whole/ground/crushed/flakes), 0.24 for black pepper (whole/ground/cracked), 0.56% for coriander seed (ground), 0.19% for curry powder (ground mixture of spices), 0.49% for dehydrated garlic (powder/granules/flakes), 0.15% for oregano leaf (whole or ground/crushed/flakes), 0.25% for paprika (ground/cracked), 0.64% for red pepper (hot red pepper, e.g., chili, cayenne; ground/cracked/crushed/flakes). This study also examined samples of these same 11 spice types from shipments of imported spices offered for entry to the U.S.

during 2011 to 2015. Salmonella prevalence estimates for shipments of imported spice ranged from 1.7 to 18%. The Salmonella prevalence estimates for spices offered for sale at retail establishments for all of the spice types except dehydrated garlic and basil were significantly lower than estimates for shipments of imported spice offered for entry (Zhang et al., 2017).

A total of 3,656 samples of 6 tree nuts were collected from different types of retail stores and markets throughout the U.S. between October 2014 and October 2015. Of the 3,656 samples collected and tested, 32 were culturally confirmed as containing Salmonella. Among these isolates, there were 25 serotypes. Salmonella was not detected in pecans and in-shell hazelnuts.

Salmonella prevalence estimates in cashews, shelled hazelnuts, pine nuts, walnuts and macadamia nuts were 0.55, 0.35, 0.48, 1.20, and 4.20 %, respectively. The rates of Salmonella isolation from major/big chain supermarkets, small chain supermarkets, discount/variety/drug stores, and online, were 0.64, 1.60, 0.00, and 13.64 %, respectively. The rates of Salmonella isolation for conventional and organic nuts were not statistically different. Of the enumerated samples, 60.7% had Salmonella levels less than 0.003 MPN/g. The highest contamination level observed was 0.092 MPN/g. This is the first report on a large scale survey of Salmonella in tree nuts nationwide (Zhang, et. al., 2017). In a follow-up study (Zhang et el., 2021), a total of

3,374 samples of 8 tree nuts were collected from different types of retail stores and markets nationwide between September 2015 and March 2017. These samples (375 g) were analyzed using a modified FDA BAM Salmonella culture method. Of the 3,374 samples, 15 {0.44%

(95% Confidence Interval [0.25, 0.73])} were culturally confirmed as containing Salmonella;

17 isolates were obtained. Among these isolates, there were 11 serotypes. Salmonella was not detected in Brazil nuts (296), hazelnuts (487), pecans (510), pine nuts (500), and walnuts (498).

Salmonella prevalence estimates in cashews (510), macadamia (278), and pistachios (295) were 0.20 [<0.01, 1.09], 2.52 [1.02, 5.12], and 2.37 [0.96, 4.83] %, respectively. The rates of

Salmonella isolation from major/big chain supermarkets (1381), small chain supermarkets

(328), discount/variety/drug stores (1329), and online (336), were 0.29 [0.08, 0.74], 0.30 [0.01, 1.69], 0.45 [0.17, 0.98], and 1.19 [0.33, 3.02] %, respectively. Salmonella prevalence in organic (530) and conventional (2844) nuts was not different statistically (p = 0.0601). Of the enumerated samples (15), 80% had Salmonella levels ≤0.0092 Most Probable Number

(MPN)/g. The highest contamination level observed was 0.75 MPN/g.

The FDA surveys above provided the first urgently needed information for formulation of FDA regulations and accurate food industry risk assessments for these high risk and ubiquitous food commodity. However, there are still many data gaps for some RTE foods, such as salads, papayas, raw milk, etc.

In addition to concerns about RTE foods, there are also concerns regarding the contamination of cosmetic products. Products can become contaminated during manufacture or by the consumer during use. Microbial contamination may cause changes in the composition, color or odor of the product, but more importantly can pose unnecessary health risks for the consumer. Investigation of recalled products has revealed the presence of a variety of pathogens including Pseudmonas aeruginosa, Staphylococcus aureus, Burkholderia cepacia, Enterobacter spp., and Aspergillus spp. The health risks are especially acute when the products are used for infants and imunocompromised individuals or for any products used around the eye area. Application of contaminated products has resulted in skin infections and eye infections. Some serious eye infections have resulted in permanent blindness from the use of contaminated eye products.

Another major concern related to FSMA is the microbiological status of agricultural water.

Generic E. coli test for agricultural water is required by Produce Rule. The required criteria include a geometric mean (GM) of 126 CFU or less of generic E. coli per 100 mL of water and a standard threshold value (STV) of 410 CFU or less of generic E. coli in 100 mL of water.

However, there are no reliable available data on this of the water used in agriculture. Although testing of foodborne pathogens, such as Salmonella, Listeria monocytogenes and STEC, in agricultural water are not required by Produce Rule, use of contaminated water containing these bacteria could transfer pathogens to foods and eventually cause outbreaks. Information in this area is urgently needed to protect public health.

Whole-genome sequencing technology is contributing long anticipated solutions to what were once viewed as insurmountable challenges, in the genetic analysis of bacterial pathogens.

Complete genome sequences from numerous bacterial strains can currently be collected and analyzed in just a few days, underscoring the potential of this technology as a molecular epidemiological tool to assist in foodborne outbreak investigations. Recent examples in the literature illustrate the ability of NGS to discern the high-resolution genetic relatedness of otherwise indistinguishable isolates based on the micro-evolutionary genetic change that define clinical isolates, outbreak isolates found in foods, and their environmental counterparts.

Sequencing food, clinical and environmental isolates will help FDA’s mission of protecting public health.

Tobacco use is the leading cause of preventable illness in the United States and is responsible for more than 443,000 deaths annually. On June 22, 2009, the President signed the Family

Smoking Prevention and Tobacco Control Act (Tobacco Control Act) into law. The Tobacco

Control Act added sections 904(a)(1), 904(a)(3), and 915 to the Federal Food, Drug, &

Cosmetic Act (FD&C Act), that requires each tobacco product manufacturer or importer, or an agent, to test and report constituents, ingredients, and additives to FDA. In addition, the

Tobacco Control Act provides FDA authority to regulate cigarettes, cigarette tobacco, roll-your-own tobacco, smokeless tobacco, and any other tobacco products that the Agency by regulation deems to be subject to the law. On August 8th, 2016 FDA published the Deeming

Tobacco Products To Be Subject to the Federal Food, Drug, and Cosmetic As, as Amended by the Family Smoking Prevention and Tobacco Control Act rule. FDA is extending the

Agency’s “tobacco product” authorities in the FD&C Act to all other categories of products that meet the statutory definition of “tobacco product” in the FD&C Act, including ENDS, waterpipes, pipes, cigars, and more. This testing and reporting may require method development and validation. Given the diversity of tobacco products, it is imperative that

FDA be able to conduct various tobacco-related research projects to effectively regulate all tobacco products as defined in the FD&C Act. These projects will vary in scope and specific aims/objectives depending on the needs of the FDA in fulfilling its regulatory requirements.

1.2 NOTICE OF COMBINED SYNOPSIS/SOLICITATION

This is a combined synopsis/solicitation for commercial items prepared in accordance with

(IAW) the format in FAR Subpart 12.6, as supplemented with additional information included in this notice. This announcement constitutes the only solicitation; proposals are being requested and a written solicitation will not be issued. This is a request for proposal

(RFP) for commercial items IAW the procedures of FAR Part 12 – Acquisition of

Commercial Items, in conjunction with FAR Part 15 – Contracting by Negotiation.

1.3 NOTICE OF FAC

This solicitation document incorporates provisions and clauses in effect through Federal

Acquisition Circular FAC 2022-03, effective January 01, 2022.

1.4 NOTICE OF NAICS/SET ASIDE

This requirement is intended for full and open competition. The associated North American

Industry Classification System (NAICS) code is 541380, Testing Laboratories. Its associated

Small Business Size Standard is $16.5 Million. Offerors must have an active registration in

SAM.gov (https://beta.sam.gov), with completed representations and certifications, by the close date of the solicitation. Proposals submitted by offerors not registered in SAM.gov will not be considered.

2 DESCRIPTION OF REQUIREMENT/STATEMENT OF WORK

2.1 OBJECTIVE

The objective of this IDIQ is to obtain baseline survey data on FDA-regulated food, agricultural water, cosmetics products, and environmental samples. These products shall be analyzed for the presence of and, in some cases, levels of one or several pathogens, including, but not limited to, Salmonella, Listeria monocytogenes, E. coli O157:H7, non-O157:H7 STECs, Shigella spp., Campylobacter spp., Vibrio spp., Staphylococcus aureus, Bacillus cereus, Cronobacter spp., COVID-19, Norovirus, hepatitis A, Cyclospora, and Cryptosporidium. The contractor shall conduct whole genome sequencing (WGS) of collections of food and environmental isolates, or other microorganisms of interest to FDA, have the capacity to submit the WGS data to NCBI database.

This project shall support FDA’s mission of protecting the public health by generating baseline data regarding the microbiological safety of selected food, agricultural water, environmental samples and cosmetics commodities and by identifying contaminated foods or products which shall be removed from the nation’s food supply; or contaminated agricultural water which should not be used for crops.

2.2 SCOPE OF WORK

Independently, and not as an agent of the Government, furnish the necessary personnel, services, and otherwise do all things necessary for, or incident to, the performance of the work.

The contractor shall provide trained staff that can perform the tasks as described in this

Statement of Work (SOW) providing quality work.

2.3 SPECIFIC TASKS

The contractor tasks include:

• Collect food, agricultural water, environmental samples, and/or cosmetic samples nationwide (abroad if necessary) that would have a broad representation of the test targets. Samples should be obtained from at least one location in each of the US Census

Bureau-designated areas (i.e., Northeast, Midwest, South, and West)

(https://www.census.gov/geo/reference/gtc/gtc_census_divreg.html). Most times, the sampling locations should cover all or most of the Census Bureau-designated divisions.

• Samples that will be collected and tested include, but are not limited to: agricultural water, manures, composts, soils, raw milk, salads, soft cheeses, smoke fish, green onions, leafy green produce and herbs, nuts, fruits (papayas, peaches, apples, etc.), CBD, all https://beta.sam.gov/ https://www.census.gov/geo/reference/gtc/gtc_census_divreg.html foods regulated by FDA, eye area cosmetics (eye shadow, mascara, eye liner), all types of cosmetic powder, lipsticks, and lip liner.

• Process the collected samples as follows. Pathogens might be tested for presence/absence and/or be enumerated include:

o Salmonella o Listeria monocytogenes o Enterohemorrhagic E. coli O157:H7 & non-O157:H7 STECs o Shigella spp.

o Campylobacter spp.

o Vibrio spp.

o Staphylococcus aureus o Bacillus cereus o Cronobacter spp.

o virus o Hepatitis A o Cyclospora o Cryptosporidium spp.

o Any other organisms FDA need

• Microbiological methods for each analysis shall be determined and provided by the FDA.

Sample sizes will vary from 25 to 375 g, depending on the matrix.

o Salmonella analysis shall be performed using the method described in the BAM

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/UCM070149) or any appropriate Salmonella method found in the Official Methods of Analysis (OMA: Official Methods of Analysis of

AOAC INTERNATIONAL, 18th Ed., Revision 4, 2011. AOAC

INTERNATIONAL, Gaithersburg, MD).

o L. monocytogenes analysis shall be performed using the method described in the

BAM

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/UCM071400) or any appropriate L. monocytogenes method found in the Official Methods of Analysis (OMA: Official Methods of Analysis of o E. coli O157:H7 & non-O157:H7 STEC analysis shall be performed using the method described in the BAM

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/UCM070080), except that samples currently specified for rinse shall be subjected to a whole soak method rather than the rinse method currently recommended by the BAM, or any appropriate E. coli O157:H7 & non-

O157:H7 STEC method found in the Official Methods of Analysis (OMA: Official

Methods of Analysis of AOAC INTERNATIONAL, 18th Ed., Revision 4, 2011.

http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalAnalyticalManualBAM/UCM070149 http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalAnalyticalManualBAM/UCM070149 http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalAnalyticalManualBAM/UCM071400 http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalAnalyticalManualBAM/UCM071400 http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalAnalyticalManualBAM/UCM070080 http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalAnalyticalManualBAM/UCM070080

AOAC INTERNATIONAL, Gaithersburg, MD).

o Agricultural water testing for generic E. coli shall follow EPA’s method 1603:

Escherichia coli (E. coli) in Water by Membrane Filtration Using Modified membrane-Thermotolerant Escherichia coli Agar (Modified mTEC) (December

2009). Available at: https://nepis.epa.gov/Exe/tiff2png.cgi/P1002DAB.PNG?-r+75+-g+7+D%3A%5CZYFILES%5CINDEX%20DATA%5C06THRU10%5CTIFF%5

C00000255%5CP1002DAB.TIF. Other equivalent methods listed by FDA are:

(1) Method 1103.1: Escherichia coli (E. coli) in Water by Membrane Filtration

Using membrane-Thermotolerant Escherichia coli Agar(mTEC) (March 2010).

U.S. Environmental Protection Agency.EPA-821-R-10-002.

(2) Method 1604: Total Coliforms and Escherichia coli in Water by Membrane

Filtration Using a Simultaneous Detection Technique (MIMedium) (September

2002). U.S. Environmental Protection Agency.EPA-821-R-02-024.

(3) 9213 D – Natural Bathing Beaches (2007). In: Standard Methods for the

Examination of Water and Wastewater, 22nd Edition (Rice E.W., et al., Ed.), 9-46

– 9-48. Washington, DC: American Public Health Association. (2012).

(4) 9222 B – Standard Total Coliform Membrane Filter Procedure (1997), followed by 9222 G – MF Partition Procedures (1997) using NA-MUG media. In:

Standard Methods for the Examination of Water and Wastewater, 21st Edition

(Eaton A.D., et al., Ed.), 9-60 – 9-65, and 9-70 – 9-71, respectively. Washington, DC: American Public Health Association. (2005).

(5) D 5392-93 – Standard Test Method for Isolation and Enumeration of

Escherichia coli in Water by the Two-Step Membrane Filter Procedure. In:

Annual Book of ASTM Standards, Volume 11.02. ASTM International. (1996, 1999, 2000).

(6) Hach Method 10029 for Coliforms – Total and E. coli, using m-ColiBlue24

Broth Pour Rite Ampules.

(7) IDEXX Colilert Test Kit, but only if using IDEXX Quanti-Tray/2000 for quantification.

(8) IDEXX Colilert-18 Test Kit, but only if using IDEXX Quanti-Tray/2000 for quantification.

Salmonella testing in agricultural water shall follow EPA Method 1200:

Analytical Protocol for Non-Typhoidal Salmonella in Drinking Water and Surface

Water (May 2012) or any other equivalent validated method in consultation with project officer.

Any other pathogens (such as Listeria monocytogenes, STEC, etc.) shall follow sample preparation procedures described in EPA methods 1200 or 1603, then https://nepis.epa.gov/Exe/tiff2png.cgi/P1002DAB.PNG?-r+75+-g+7+D%3A%5CZYFILES%5CINDEX%20DATA%5C06THRU10%5CTIFF%5C00000255%5CP1002DAB.TIF https://nepis.epa.gov/Exe/tiff2png.cgi/P1002DAB.PNG?-r+75+-g+7+D%3A%5CZYFILES%5CINDEX%20DATA%5C06THRU10%5CTIFF%5C00000255%5CP1002DAB.TIF https://nepis.epa.gov/Exe/tiff2png.cgi/P1002DAB.PNG?-r+75+-g+7+D%3A%5CZYFILES%5CINDEX%20DATA%5C06THRU10%5CTIFF%5C00000255%5CP1002DAB.TIF https://nepis.epa.gov/Exe/tiff2png.cgi/P1002DAB.PNG?-r+75+-g+7+D%3A%5CZYFILES%5CINDEX%20DATA%5C06THRU10%5CTIFF%5C00000255%5CP1002DAB.TIF proceed to preenrichment and other steps for respective pathogens in the current

FDA BAM. To use any test method not specified here, the contractor must consult with the project officer.

o Shigella spp. analysis shall be performed using the following method:

DETECTION AND ISOLATION OF SHIGELLA SPECIES FROM PRODUCE

NOTES:

• There are two rounds of PCR analyses in the method. The initial

Polymerase Chain Reaction (PCR) should be performed after overnight growth of samples: templates should be prepared at 0 and overnight time periods. The second round of PCRs will be performed ONLY IF any of the time points (0, overnight) are positive in the initial PCR.

• Microbiological analysis (plating) after overnight incubation should be performed ONLY IF any of the time points (0, overnight) are positive.

• Suspect colonies on either MacConkey or Shigella Rainbow agar should be confirmed by PCR.

I. Media and reagents:

For preparation of media and reagents, refer to the Bacteriological Analytical

Manual (BAM). The number in parentheses following each medium refers to its listing in the media section of the BAM.

Media

(1) Shigella broth with novobiocin (M136)

(2) Shigella Rainbow agar (provided by Dr. Rachel Binet) (see note below)

(3) MacConkey agar (M91)

Note: In preparation of Rainbow agar, please read the directions on the packet. It is important to note that excessive heating will affect the medium composition. Also, please pour a minimum of 25 ml per plate.

Reagents

(1) 1N Sodium hydroxide solution (R73)

(2) 1N Hydrochloric acid (R36)

(3) Phosphate buffered saline (PBS) formulation: 11.42 grams

NaCl, 1.08 grams Na2HPO4, 0.315 grams KH2PO4, 1.5 liters dH2O pH 7.4

II. Enrichment in broth medium:

1- Prep of 0 hour PCR template:

a. From the 125 ml rinse, place 2 x 10 ml into two 15 ml centrifuge tubes (see note below). Centrifuge the tubes at 6000 rpm for 5 min.

Remove supernatant (to avoid leaving behind any inhibitory compounds; aspiration may be a better alternative than decanting the supernatant). Suspend and combine the pellet from each tube in 1 ml of PBS and transfer the suspended material to a 1.5 ml microcentrifuge tube.

b. Centrifuge again at 6,000 rpm for 5 minutes. Carefully remove supernatant. Re-suspend pellet in 50 µl PBS, and transfer to a freezer for overnight incubation. The 0 hr PCR template (or 0 hr PCR analyte) will be subsequently prepared as described below in III.1., on the following morning, when the overnight enrichment samples are being processed.

NOTE:

1. If enrichment broth culture appears to contain large amounts of plant material and debris:

• Decant approximately 2 x 10 ml of the rinse from sample into two 15 centrifuge tubes.

• Perform a slow-speed spin (2000 rpm for 2 minutes) to remove debris.

• Carefully transfer 10 ml of supernatants to fresh 15 centrifuge tubes.

• Continue with protocol as in IIa.

2. For samples received in the afternoon, we recommend holding the 2 X 10 ml rinse under refrigeration overnight, rather than postponing enrichment to the following day. The rinse will then be processed on the following morning as explained in II

1 a and b.

2- Enrichment:

a. Transfer remaining 105 ml of rinse from above to a sterile 500 ml Erlenmeyer flask containing 105 ml of 2X Shigella broth with novobiocin (final concentration of novobiocin in the enrichment broth should be 0.5 ug/ml; therefore, in 2X recipe, concentration of novobiocin is 1.0 ug/ml).

b. Adjust pH, if necessary, to 7.0 ± 0.2 with sterile 1 N NaOH or 1

N HCl.

c. Incubate at 37oC +/- 2oC for overnight incubation, aerobic conditions, with shaking (125-150 rpm).

3- Prep of overnight PCR template:

a. After overnight incubation, remove 1 ml of culture and place in

1.5 ml centrifuge tube. Centrifuge at 6,000 rpm for 5 minutes to pellet bacterial cells. Remove as much of the supernatant as possible (to avoid leaving behind any inhibitory compounds;

aspiration may be a better alternative than decanting the supernatant).

b. Re-suspend pellet in 500 µl PBS. Follow protocol as explained in III.

III. Initial PCR:

Important note: All PCRs should be performed at the same time, i.e.

after PCR template has been prepared from the overnight culture.

1. Template Preparation:

Boil the cell suspensions [0 h and overnight incubation] for 5 minutes in a heating block set at 100°C, cool on ice and centrifuge at 13,000 rpm for 3 minutes. Transferring the supernatant to another tube is not necessary; use the supernatant as template without disturbing the pellet.

2. PCR setup:

Amplify each DNA template using the following PCR protocol – The following is a typical set up for PCR methodology - .

1. H20 4-6.5 l

2. Mix* 12.5 l, 2 X stock

3. Primers2.5 l each primer ipaHF and ipaHR (10 pmoles/l stock) (provided)

4. Template1-2.5l (e.g., 1 l positive control or 2.5 l PCR template prep)

Total volume is 25 l

*HotStart Taq TMMaster Mix Kit (Qiagen) includes buffer, Taq DNA polymerase, dNTPs, MgCl2). Equivalent DNA polymerases and PCR mixes can be used.

Primer sequences:

ipaHF: 5’GTT CCT TGA CCG CCT TTC CGA TAC CGT C 3’ ipaHR: 5’GCC GGT CAG CCA CCC TCT GAG AGT AC 3’

The ipaHF and ipaHR primers target the ipaH genes-there are 9 copies in the chromosome and virulence plasmid.

3. PCR Amplification:

PCR cycles and steps are as follow –

i. First file is set at 95ºC for 15 minutes

ii. An amplification cycle consists of the following steps:

1. 94ºC for 1 minute (denaturation)

2. 60ºC for 1 minute (annealing)

3. 72ºC for 1 minute (extension)

Total number of cycles is 30.

iii. 4ºC for indefinite period of time (soak file)

4. Agarose Gel Analysis of PCR Products:

After amplification, analyze PCR products on agarose gels. Transfer 10 µl of the PCR products to a new microcentrifuge tube containing 2 µl of tracking dye and load on 1% agarose gel.

• Do not add dye directly to the PCR product.

• A 100 base pair ladder is used as a molecular weight standard.

• A 620 base pair product is expected from the positive samples.

• It is recommended that the positive control 2457M be used to ensure that the PCR reagents are working properly. 2457M is a S. flexneri strain that is provided on a slant and should be streaked out onto nutrient agar plate (e.g., isolated colonies). This positive control strain can be differentiated from any other Shigella isolate with another set of primers (607, 608; see below), if needed, and its resistance to the antibiotic kanamycin [50 g/ml].

• Template for the control strain is prepared by boiling a colony from an agar plate in 150 l dH20 and using 1 l in a PCR control tube.

When reactions are completed, hold PCR product at 4ºC or stored at -

20ºC.

IV. Bacteriological testing: - ONLY IF any of the PCRs from 0, and overnight incubation time points produces a 620 bp band in the first round of

PCR.

1- Plating

After overnight incubation, and ONLY IF any of the PCRs from 0 and overnight incubation time points are positive, prepare 10-fold serial dilutions in PBS to 10-6.

Spread 100 µl from each of the 10-3 through 10-6 dilutions onto two Shigella

Rainbow agar plates and MacConkey plates. Incubate plates overnight (16 to 24 hrs) at 37°C +/- 2°C.

2- Picking colonies

a. Identify suspect colonies. Follow standard microbiological criteria for examining test results.

The characteristics of Shigella colonies are summarized as follows:

(1) Shigella Rainbow agar: Shigella colonies are mauve (a dull pink-purple color). The color is darkest in the center of the colony and fades to near colorless around the edges.

(2) MacConkey: Shigella colonies are lactose negative on MacConkey agar.

b. Select six to twelve suspect colonies. Pick colonies from agar plates that have 30-300 colonies. Perform the following on each colony -

Pick part (not the entire colony) of each colony and inoculate a TSA agar slant.

Incubate slants at 37°C + 2°C for 20 hrs.

Prepare lysates from suspect colonies (see c. below) and test via PCR protocol (First round; see III).

3- Lysate Prep

a. From a section of the remaining suspect colony, pick a small amount of colony material. Transfer this material to a 1.5 ml centrifuge containing

150 µl of dH2O. Boil for 5 min, in a heating block set at 100°C, cool on ice and then use 1 µl in PCR (First round; see III)).

b. With PCR positive identification of colonies from aforementioned plating, further biochemical identification/confirmation is indicated.

V. Second Round PCRs: ONLY IF any of the PCRs from 0, and overnight incubation time points produces a 620 bp band in the first round of PCR.

The second round of PCRs is mostly confirmatory in nature. On one hand, all isolates producing a 620 bp band should be confirmed by nested PCR with secondary ipaH3-4 primers. On the other hand, 607 and 608 control primers will be used in an independent PCR reaction to make sure the positive samples are not due to cross contamination with the control strain.

Both reactions can be run simultaneously (not multiplex) to ensure proper quality control of sample processing.

• Nested PCR reaction

The objective of using the nested PCR assay is to confirm that the 620 bp fragment obtained in the initial PCR analysis was amplified from Shigella.

Primers ipaH3 and ipaH4 are directed to internal sequences within the 620 bp amplicon generated from PCR using primers ipaHF and ipaHR.

Using primers ipaH3 and ipaH4, a 290 bp product should be amplified if the 620 bp fragment was generated from Shigella DNA.

Primer sequences:

ipaH3: 5'-CCA CTG AGA GCT GTG AGG ipaH4: 5'-TGT CAC TCC CGA CAC GCC

• Usually if 1 µl of the PCR product (620 bp fragments) of the first round is used directly as template, then 3 bands may be seen on the gel;

• the correct band at 290 bp

• 2 other approximately 400 and 500 bp.

The larger 2 bands are due to primers ipaHF and ipaHR being carried over from the first reaction. The larger amplified bands were generated from the combinations of ipaHF-ipaH4 and ipaHR-ipaHF.

To avoid these extra bands:

• dilute the reactions that yielded a presumptive positive product

1:10 and 1:100 in separate tubes with dH2O.

• Use 1 µl of the diluted products as template.

• In some cases, faint bands around 400 and 500 bp may be seen on agarose gels using the 1:10 diluted product as template; this is explained above. A band at 290 bp is confirmation for the presence of Shigella.

• PCR for Strain Verification

Utilize 607 and 608 control primers to make sure the positive samples are not due to cross contamination with the control strain

Use the lysate that produced the 620bp fragment in the first round PCR as template (see III 1). Alternatively, use lysates prepared from suspected

Shigella colonies (see IV 3.).

Amplification (PCR) with primers 607 and 608 will yield a 1.8 kb amplicon from the control strain (2457M) only; all other Shigella spp. will have a 1.0 kb amplicon.

Primer sequences:

607: 5'- ATG CTT GAT GTT AAA AAT ACA GGA G-3’

608: 5'- GCT CTT TCT TGT ATG CAC TTG TG-3’

A negative result, i.e. no PCR product from reactions using primers 607 and 608 only should not be interpreted as being negative for Shigella; the virulence plasmid could be completely or partially deleted.

• PCR Set-Up

1. Distilled water 6.5 µl

2. Mix* 12.5 µl

3. Primers 2.5 µl ipaH3 or 607 (stock is 10 pmol/µl)

2.5 µl ipaH4 or 608 (stock is 10 pmol/µl)

4. Template 1.0 µl

Total volume is 25 l

*HotStart Taq TMMaster Mix Kit (Qiagen) ) includes buffer, Taq DNA polymerase, dNTPs, MgCl2). Equivalent DNA polymerases and PCR mixes can be used.

PCR cycles and steps are as follow –

i. First file is set at 95ºC for 15 minutes

ii. An amplification cycle consists of the following steps:

1. 94ºC for 1 minute (denaturation)

2. 56ºC for 1 minute (annealing)

3. 72ºC for 1 minute (extension)

Total number of cycles is 30.

iii. 4ºC for indefinite period of time (soak file)

Running gel:

After reactions are complete, run 8-10 µl of each amplicon through an agarose gel:

• 1 % agarose gel in 0.5 X Tris-acetate EDTA buffer, pH 8.3.

• Each gel should have a 100 bp ladder as molecular weight marker.

• A positive reaction generates an intense 290 bp fragment in the nested PCR reaction, and a 1kb fragment [not 1.8 kb indicative of the control strain] in the PCR for strain verification.

And https://www.fda.gov/food/laboratory-methods-food/bam-chapter-6-shigella.

o Campylobacter spp. analysis shall be performed using the method described in the

BAM

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/ucm072616.htm), or any appropriate Campylobacter spp.

method found in the Official Methods of Analysis (OMA: Official Methods of

Analysis of AOAC INTERNATIONAL, 18th Ed., Revision 4, 2011. AOAC o Vibrio spp. analysis shall be performed using the method described in the BAM

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/ucm070830.htm), or any appropriate Vibrio spp. method found in the Official Methods of Analysis (OMA: Official Methods of Analysis of o Staphylococcus aureus analysis shall be performed using the method described in the BAM

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/ucm071429.htm), or any appropriate Staphylococcus aureus method found in the Official Methods of Analysis (OMA: Official Methods of Analysis of AOAC INTERNATIONAL, 18th Ed., Revision 4, 2011. AOAC o Bacillus cereus analysis shall be performed using the method described in the

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/ucm070875.htm), or any appropriate Bacillus cereus method found in the Official Methods of Analysis (OMA: Official Methods of o Cronobacter spp. analysis shall be performed using the method described in the

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/ucm289378.htm), or any appropriate Cronobacter spp.

method found in the Official Methods of Analysis (OMA: Official Methods of o Norovirus & Hepatitis A

CONCENTRATION AND EXTRACTION OF NOROVIRUS AND HEPITITIS A FROM

PRODUCE

Procedure

Material and Equipment: The following materials and equipment shall be identified in each individual resultant orders against this contract.

Glycine (Sigma G-7126 or equivalent; TLC grade or better)

Nuclease free-water Applied Biosystems (AM9937) 10 x 50ml

NaCl

Ethanol (95-100%)

Biological Safety Cabinets (BSC-2)

RNase-free latex or nitrile gloves

Vortex Mixer

Pop micro-centrifuge

Micro-centrifuge, bench top, capable of ≥10,000 x g

Dedicated Virus, calibrated pipettors (P10, P20, P200 or equivalent)

Dedicated RNA, calibrated pipettors (P10, P20, P200 or equivalent)

Qiagen QIAamp Viral RNA Mini Kit Cat No. 52904 (50) or 52906 (250)

Qiagen QIAshredder Cat No. 79654 (50) or 79656 (250)

Qiagen Collection Tubes Cat No. 19201

Filter-Barrier aerosol resistant pipette tips

Bench top cooling block, pre-chilled to 4⁰C (preferable) or Ice Bucket with Ice

Micro-centrifuge tubes, 1.5-1.7 ml, (siliconized, certified DNase & RNase free, AB)

High speed centrifuge with rotor capable of holding Falcon 50 ml tubes (or equivalent), 9,000-12,000 x g

50 ml conical tubes (Fisher Scientific Cat No. 14-959-49A) (part #); was not previously on the list

Sorval WX Ultra Centrifuge or equivalent

Carbon Fiber Rotor F40L, 8 x 100 ml; Cat. # 096-087057 or equivalent

70 ml Polycarbonate ultracentrifuge tubes w/ aluminum cap tubes for F40L rotor (Cat

No. 010-1333 or equivalent)

Shaker (orbital or side-by-side)

Balance (tubes must be within 0.05g for balance of rotor)

Extraction Control Virus:

Murine Norovirus available at ATCC is to allow the establishment of extraction efficiency.

Work instruction details

Before starting RNA extraction place AVE elution buffer in a 70⁰C heating block.

*For validation protocol, proceed to step 2*

1. Add 50 g ± 2 g of produce cut in 2-5” pieces to a whirl-pak plastic bag.

• Note: Include all parts of the produce present including roots to leaves

• Note: Murine NoV is to be applied to sample at this stage to allow the establishment of extraction efficiency. (quantification via RT-qPCR)

2. Add 55 ml ± 2 ml of 0.75 M Glycine, 0.15 M NaCl Buffer, pH 7.6 and seal.

3. Shake at 200 rpm or medium speed for 15 min at room temperature.

4. Decant into a 50 ml tube (Falcon 2089 Disposable or similar) let bag sit for 2-3 min, shake side to side and pour remaining liquid into centrifuge tube.

5. Centrifuge at 9,000 x g for 30 min at 4⁰C (2-22⁰C).

6. Decant supernatant into a 50-70 ml Ultra-centrifuge tube.

7. Balance tubes to within 0.05 g of each other using Glycine Buffer (0.75 M Glycine,

0.15 M NaCl; pH 7.6)

• minimum volume for ultracentrifugation using Fiberlite rotor and tubes is 50ml, add glycine/NaCl buffer to bring volume to ≥ 50ml

8. Centrifuge 37,000 rpm (170,000 x g) for 60 min at 4⁰C (rpm speed is specific for

F40L rotor, if using different rotor check speed for 170,000 x g)

9. Label QIAshredder and QIAamp Spin column with sample number.

10. Pour (discard) off supernatant (should see pellet on side of tube), let tubes sit for 4-5 min and remove and discard remaining liquid with micro pipettor.

11. Add 280 µl of glycine buffer to tube, carefully resuspend sample, and evenly distribute sample into two 1.5 ml DNase/RNase free tubes. Use only 1 of the tubes for RNA extraction. Store other tube at -70⁰C.

12. Add 560 µl prepared (see attachment) AVL Buffer w/ carrier RNA tube.

13. Incubate at room temperature (15-25⁰C) for 10 min.

14. Resuspend pellet by pipetting up and down and vortexing.

15. Transfer all liquid to the QIAshredder.

16. Centrifuge 2 min at maximum speed

17. Label microcentrifuge tubes with sample number

18. Carefully transfer the supernatant of the flow-through fraction to a new microcentrifuge tube without disturbing the cell-debris pellet (if present) in the collection tube.

19. Add 560 µl of ethanol (95/100%) to the cleared lysate, and mix immediately by pipetting. Do not centrifuge. Continue without delay to next step.

20. Apply 630 µl of the solution to an QIAamp mini column

21. Centrifuge 8,000 x g (≥10,000 rpm) for 1 min. Place QIAamp spin column in new collection tube. Discard flow through and collection tube

22. Continue to add sample until the entire sample (from both microfuge tubes) has been passed through the column, discarding collection tube each time.

23. Add 500 µl Buffer AW1. Incubate for 10 min. Centrifuge 60 sec at 8,000 x g (@

10,000 rpm). Discard flow through and collection tube.

24. Transfer the QIAamp mini column into a new 2 ml collection tube. Pipet 500 µl

Buffer AW2 onto the QIAamp Mini column. Centrifuge at full speed (20,000 x g)

(14,000 rpm) for 3 min. Discard flow through and collection tube

25. Transfer the QIAamp mini column into a new 2 ml collection tube. Centrifuge at full speed (20,000 x g) for 1 min (14,000 rpm) to dry column.

26. To elute RNA, transfer the QIAamp mini column in to a new 1.5 ml DNase/RNase free centrifuge tube. Pipet 35 µl of heated Buffer AVE directly onto the QiaAmp silca-gel membrane. Close the tube gently, and centrifuge for 1 min at ≥8,000 x g (≈

10,000 rpm) to dry column

27. Add 25 µl of heated Buffer AVE to column. Pipette the eluted 35 µl back to the top of the column. Close the tube gently, and centrifuge for 1 min at ≥8,000 x g (≈ 10,000 rpm) to dry column.

28. Label samples, use immediately, place elute on ice, or freeze at -70⁰C for long term.

29. This RNA is suitable for RT-PCR assay for virus detection. (e.g. human norovirus, Murine Norovirus, hepatitis A virus)

Extraction Solutions

0.75 M Glycine, 0.15 M NaCl Buffer, Ph 7.6

NaCl 8.8 g

Glycine (Sigm G-7126 or equivalent) 56.3 g

Distilled Water 800 ml H2O q.s. with distilled water to 1 liter pH to 7.6

Autoclave and store at 4⁰C

AVL Buffer and AVE/Carrier RNA mix

Volumes of Buffer AVL and carrier RNA-Buffer AVE mix required for the QIAamp

*store remaining carrier RNA in 30µl aliquots at -20⁰C.

No. samples Vol. Buffer

AVL (ml)

Vol. carrier

RNA-AVE

(µl)

No. samples Vol. Buffer

AVL (ml)

Vol. carrier

RNA-AVE

(µl)

1 0.56 5.6 13 7.28 72.8

2 1.12 11.2 14 7.84 78.4

3 1.68 16.8 15 8.40 84.0

4 2.24 22.4 16 8.96 89.6

5 2.80 28.0 17 9.52 95.2

6 3.36 33.6 18 10.08 100.8

7 3.92 39.2 19 10.64 106.4

8 4.48 44.8 20 11.20 112.0

9 5.04 50.4 21 11.76 117.6

10 5.60 56.0 22 12.32 123.2

11 6.16 61.6 23 12.88 128.8

12 6.72 67.2 24 13.44 134.4

Detection of Enteric Viruses via RT-qPCR

Materials and Methods

Equipment/Supplies

1. RNase-free microcentrifuge tubes, 0.5 and 1.5 ml, preferably non-stick, siliconized

2. Microcentrifuge (0.5 – 2.0 ml volume)

3. Ice Bucket and ice, or bench top cooler

4. RNase Away

5. Smart Cycler tube holder

6. Smart Cycler cold block for Smart cycler tubes (-20⁰C)

7. Adjustable Micropipettors (0.2-1000 µl), for RNA work only

8. Aerosol resistant Micropipettor tips (0.2-1000 µl)

9. Vortex Mixer

10. Smart Cycler Reaction Tubes, 25-µl capacity.

11. RNase-free latex or nitrile gloves – Powder Free

12. Cepheid Smart Cycler II

13. Smart Cycler tube mini-centrifuge with Smart Cycler adapter

Reagents

1. Qiagen OneStep RT-PCR Kit; Cat No. 210210 (25 reactions) or 210212 (100 reactions)

a. OneStep Kit Components

i. OneStep RT-PCR Enzyme Mix

ii. OneStep RT-PCR Buffer (5X)

iii. dNTP Mix (10mM each nucleotide)

iv. RNase-free water

v. Q-Solution (DISCARD THIS KIT COMPONENT)

2. 25 mM MgCl2

3. Ambion Superase ∙In (5 units/µl); Cat No. 2694 (2,500 U) or 2696 (10,000 U)

4. 10 µM Working Solution for each primer and probe from Table 1.

5. Internal Control RNA (available from BioGX)

RNA Template Controls and Stool Samples

Hepatitis A virus: clinical specimens or in vitro transcribed RNA

Norovirus- genogroups I and II; clinical specimens or in vitro transcribed RNA

Murine norovirus- ATCC or in vitro transcribed RNA

Note: DNA is not acceptable as a positive control molecule

Primers and Probe

All probes and primers were commercially synthesized (Integrated DNA Technologies, Coralville, IA or equivalent).

Internal Control Primer, Probes and RNA

Primers/Probe (5’ Texas Red) are covered by U.S. Patent Application 0060166232 and are currently available through a licensing agreement with Cepheid Inc./BioGX.

Primer and probe sequences for viral pathogens detection.

Target organism

Primer Sequence (5’→3’) Reference

Norovirus

GI

Forward CGYTGGATGCGNTTYCATGA Kageyama et al., 2003

Reverse CTTAGACGCCATCATCATTYAC Kageyama et al., 2003

Probe Cy5-AGATYGCGATCYCCTGTCCA-IBRQ8 Kageyama et al., 2003

Probe 2 Cy5-AGATCGCGGTCTCCTGTCCA-IBRQ Kageyama et al., 2003

Norovirus

GII

Forward CARGARBCNATGTTYAGRTGGATGAG Kageyama et al., 2003

Reverse TCGACGCCATCTTCATTCACA Kageyama et al., 2003

Probe Cy3-TGGGAGGGCGATCGCAATCT-IBRQ Kageyama et al., 2003

Hepatitis

A virus

Forward ATAGGGTAACAGCGGCGGATAT Gardener et al., 2003

Reverse AATGCATCCACTGGATGAG Gardener et al., 2003

Probe Cy5-AGACAAAAACCATTCAACGCCGGAGG-

IBRQ

Gardener et al., 2003

Murine

Norovirus

Forward

Reverse

Probe

Internal

Control

46F GACATCGATATGGGTGCCG Nordstrom et al., 2007

186R CGAGACGATGCAGCCATTC Nordstrom et al., 2007

185R GAGACGATGCAGCCATTCG Depaola et al., 2010

194R AATATTCGCGAGACGATGCAG Depaola et al., 2010

Probe Cy5-TCTCATGCGTCTCCCTGGTGAATGTG-

BHQ2

Nordstrom et al., 2007

Probe TxRed-TCTCATGCGTCTCCCTGGTGAATGTG-

IBRQ

Depaola et al., 2010

All primers and probes for this study were purchased from Integrated DNA Technologies

(Coralville, IA) or equivalent

Internal Amplification Control (IAC) primers are covered by U.S. Patent Application

0060166232.

Amplification Reaction Components for hepatitis A virus

Reagent Initial

Concentration

Volume per 25 µl reaction

Final

Concentration

RNase Free H2O 9.0 µl* -

5 X OneStep RT-

PCR Buffer

5X 5.0 µl 1 X

MgCl2 50 mM 1.5 µl 1.5 mM dNTP Mix 10 mM1 1 µl 0.4 mM

HAV1F 10 µM 1 µl 0.4 µM

HAV1R 10 µM 1 µl 0.4 µM

IC Forward 46 10 µM 0.1875 µl 0.075 µM

IC Reverse 194 10 µM 0.1875 µl 0.075 µM

HAVP 10 µM 0.5 µl 0.2 µM

Probe IC 10 µM 0.375 µl 0.15 µM

OneStep RT-PCR

Enzyme Mix

1.25 µl

Superase ∙in 5 Units/µl 0.25 µl 1.25 Units

Internal

Amplification

Control RNA

*0.2 µl

RNA 3 µl

*Amount varies with concentration of IAC RNA

Thermal cycling Conditions for HAV

Stage 1 Stage 2 Stage 3

Hold Hold 3 Temperature Cycle

Temp Sec Optics Temp Sec Optics Repeat 45 times

50 3000 Off 95 900 Off Temp Sec Optics

95 10 Off

53 25 Off

64 70 On

Amplification Reaction Components for No V Multiplex (genogroups I & II)

Master Mix RT-PCR

Components Reagent

Initial

Concentration

Volume per 25 µl reaction

Final

Concentration

RNase Free H2O 6.75 µl (variable) -

5 X OneStep RT-PCR Buffer 5X 5.0 µl 1 X

MgCl2 (25mM) 25 mM 1.50 µl Additional 1.5 mM dNTP Mix 10 mM 1.00 µl 400 µM each dNTP

COGIF 10 µM 0.75 µl 300 nM

COGIR 10 µM 0.75 µl 300 nM

COGIIF 10 µM 0.75 µl 300 nM

COGIIR 10 µM 0.75 µl 300 nM

IC 46F 10 µM 0.188 µl 75 nM

IC 194R 10 µM 0.188 µl 75 nM

COGI-Cy5 10 µM 0.250 µl 100 nM

COGIb- Cy5 10 µM 0.250 µl 100 nM

COGII- Cy3 10 µM 0.250 µl 100 nM

IC- TxR 10 µM 0.375 µl 150 nM

OneStep RT-PCR Enzyme Mix 1.0 µl -

Superase ∙In 5 Units/µl 0.25 µl 1.25 Units

Internal Control RNA 1 µl (variable; empirically determined)

RNA Target 3 µl (variable)

Thermal cycling Conditions for NoV multiplex

Stage 1 Stage 2 Stage 3

Hold Hold 3 Temperature Cycle

Temp Sec Optics Temp Sec Optics Repeat 45 times

50 3000 Off 95 900 Off Temp Sec Optics

95 10 Off

53 25 Off

62 70 On

Interpretation

Each channel is recorded individually. NoV genogroup I presence is recorded in the Cy5 channel; NoV genogroup II presence is recorded in the Cy3 channel Primary fluorescence curve that cross the fluorescence threshold set at 10 were recorded as positive. (Cepheid Smart Cycler

II)

If A FDA BAM method is available, that will be the recommended method.

o Cyclospora analysis shall be performed using the method described in the BAM

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/ucm073638.htm), or any appropriate Cyclospora method found in the Official Methods of Analysis (OMA: Official Methods of Analysis of o Cryptosporidium spp. analysis shall be performed using the method described in the BAM

(http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalA nalyticalManualBAM/ucm073638.htm), or any appropriate Cryptosporidium spp.

method found in the Official Methods of Analysis (OMA: Official Methods of o Whole genome sequencing

Due to the rapid change nature of sequencing technology, method used for sequencing will be determined and provided by FDA at the time of the task order.

Whole genome sequencing data will be delivered to the FDA according to the most current GenomeTrakr SOP posted on the NGS RedMine collaboration site.

Currently, this mode of data transfer is via Illumina’s web-based cloud storage solution Base Space.

• The appropriateness of non-BAM or AOAC OMA methods or any other method not listed above, for use with any test, shall be determined in consultation with the

Project Officer and no method for the analysis of the samples shall be used without the COR/Project Officer’s written consent.

2.4 TECHNICAL WORKPLAN

A final sampling plan shall be designed and approved working with the FDA COR/Project Officer and/or other technical advisors at the FDA. The contractor is expected to contribute their expertise to the development of the final sampling plan when necessary.

The following definitions are used in this document:

(1) RTE foods are food products that are prepared in advance and can be eaten as sold without further processing. These foods include, raw fruits and vegetables, salads, sprouts, spices, smoked fish, and cheese.

(2) Cosmetics (colloquially known as makeup or make-up) are personal care substances used to enhance the appearance or odor of the human body. They are generally mixtures of chemical compounds, some being derived from natural sources, many being synthetic. Cosmetics include lipstick, lip gloss, rouge, mascara, eye liner, facial creams, face powders, etc.

(3) “Agricultural water is defined in part as water that is intended to, or is likely to, contact the harvestable portion of covered produce or food-contact surfaces” (See FDA Produce Rule for details).

(4) Organic –TBD number of samples which qualify for the USDA National Organic Program.

(5) Non-organic – TBD number of samples ordinary RTE commodities.

2.4.1 Sample Collection

Samples shall be collected for shipment to the Contractor’s labs for analysis. Samples shall be collected and worked out in consultation with the FDA Project Officer and other technical advisors. All necessary personnel, materials, transportation, and services necessary to collect the samples shall be provided.