Attachment 1-Purchase Description.pdf
PDF 1 MB Posted
- Solicitation number
- 75N95022Q00358
View the file
Other files
On GovTribe
Work with this file
- Download the original file
- Contacts named in this file
- Similar government files
- Ask GovTribe AI about this file
Text version
Please wait...
If this message is not eventually replaced by the proper contents of the document, your PDF viewer may not be able to display this type of document.
You can upgrade to the latest version of Adobe Reader for Windows®, Mac, or Linux® by visiting http://www.adobe.com/go/reader_download.
For more assistance with Adobe Reader visit http://www.adobe.com/go/acrreader.
Windows is either a registered trademark or a trademark of Microsoft Corporation in the United States and/or other countries. Mac is a trademark of Apple Inc., registered in the United States and other countries. Linux is the registered trademark of Linus Torvalds in the U.S. and other countries.
Purchase Description Statement of Need and Purpose:
Background Information and Objective:
Generic Name of Product:
Purchase Description:
Salient Characteristics:
Quantity:
Delivery Date:
Period of Performance:
Option(s):
9.0.0.2.20101008.1.734229
| ResetButton1: |
| SaveAs: |
| Include a general narrative of the need of the requirement and the desired results.: The purpose of this procurement is the acquisition of custom RNA oligos for APP |
| Include a brief history of the requirement, the importance of the requirement, and the overall program objectives.: The National Center for Advancing Translational Sciences (NCATS) is a part of the National Institutes of Health (NIH), which mission it is to catalyze the generation of innovative methods and technologies that will enhance the development, testing and implementation of diagnostics and therapeutics across a wide range of human diseases and conditions. The Antiviral Program for Pandemics (APP) aims to develop safe and effective antivirals to combat SARS-CoV-2. APP will accelerate the development of a portfolio of promising antivirals that can quickly pivot to combat future pandemics. Having safe and effective oral antiviral candidates ready for deployment in later-stage clinical trials against a newly emergent virus would save lives, reduce serious illness and prevent overwhelming surges in hospitalizations during a viral outbreak or pandemic. |
RNA methyltransferases are used by many viruses to cap their RNA transcripts and evade the immune system. Developing inhibitors of these enzymes is a promising route for antiviral drug development. To this end, we need synthetic RNA oligos with the proper RNA cap modification to run assays for antiviral drug development. Custom RNA Synthesis by BioSynthesis provides the necessary RNA substrates needed to support antiviral research at NCATS. These RNA are used in drug screening assays for a variety of viral methyltransferases within APP. These RNAs are a necessary component of the assay as they are the enzymatic substrates processed by viral methyltransferases.
| Specify the generic name of the component or system, e.g., freezer, microscope, cell sorter, etc.: synthetic RNA oligos |
| Specify 1) trade name; 2) product’s brand name; 3) manufacturer's name; 4) model, type, catalog, and/or part number(s.): QTY 1 Gen6-N7 me7GpppACCCCC 10nmole , dual HPLC |
QTY 1 Gen6 GpppACCCCC 10nmole , dual HPLC QTY 1 CedPV5-N7 me7GpppAGGAU 10nmole , dual HPLC QTY 1 CedPV5 GpppAGGAU 10nmole , dual HPLC QTY 1 CedPV10-N7 me7GpppAGGAUCCCGG 10nmole , dual HPLC QTY 1 CedPV10 GpppAGGAUCCCGG 10nmole , dual HPLC QTY 1 CedPV15-N7 me7GpppAGGAUCCCGGUAUCU 10nmole , dual HPLC QTY 1 CedPV15 GpppAGGAUCCCGGUAUCU 10nmole , dual HPLC QTY 1 CedPV20-N7 me7GpppAGGAUCCCGGUAUCUAGAAU 10nmole , dual HPLC QTY 1 CedPV20 GpppAGGAUCCCGGUAUCUAGAAU 10nmole , dual HPLC QTY 1 COV2-6-N7 me7GpppAGGGCU 10nmole , dual HPLC Specify the significant, essential physical, functional, performance, or material element(s) (the distinguishing characteristic) of a product, system, component, or service required. Specify the functions that a system or component must perform to meet the Government’s objectives. Include required levels of performance, features or characteristics of the system or component that are essential to meet the government’s objectives. Specify the Government’s minimum acceptable standards.: high purity customizable in sequence contain the key N7-methyl modification robust assay usage Specify quantity. : QTY 1 Gen6-N7 me7GpppACCCCC 10nmole , dual HPLC QTY 1 Gen6 GpppACCCCC 10nmole , dual HPLC QTY 1 CedPV5-N7 me7GpppAGGAU 10nmole , dual HPLC QTY 1 CedPV5 GpppAGGAU 10nmole , dual HPLC QTY 1 CedPV10-N7 me7GpppAGGAUCCCGG 10nmole , dual HPLC QTY 1 CedPV10 GpppAGGAUCCCGG 10nmole , dual HPLC QTY 1 CedPV15-N7 me7GpppAGGAUCCCGGUAUCU 10nmole , dual HPLC QTY 1 CedPV15 GpppAGGAUCCCGGUAUCU 10nmole , dual HPLC QTY 1 CedPV20-N7 me7GpppAGGAUCCCGGUAUCUAGAAU 10nmole , dual HPLC QTY 1 CedPV20 GpppAGGAUCCCGGUAUCUAGAAU 10nmole , dual HPLC QTY 1 COV2-6-N7 me7GpppAGGGCU 10nmole , dual HPLC
| Specify desired delivery date after receipt of order (30-60 days.): 3 weeks after receipt of PO |
| Specify period of performance for software license, warranty, or maintenance agreements.: n/a |
| Specify if options for additional quantities or options to extend the term of the contract for service agreements.: n/a |
File details come from the government source that posted it. Updated .