A19_75D30124Q78087.docx

REQUEST FOR QUOTATIONS

(THIS IS NOT AN ORDER)

THIS RFQ IS X IS NOT A SMALL BUSINESS SET-ASIDE.

1. REQUEST NO.

75D301-24-Q-78087

2. DATE ISSUED

08/02/2024

3. REQUISITION/PURCHASE REQUEST NO.

000HCJCB-2024-86155

OTHER

(See Schedule)

FOB

DESTINATION

7. DELIVERY

)5a. ISSUED BY OFR - Office of Acquisition Services Chamblee Campus Building 102 4770 Buford Highway Atlanta GA 30341

6. DELIVERY BY (Date)

OR BEFORE CLOSE OF BUSINESS (Date) 08/21/2024 IMPORTANT: This is a request for information, and quotations furnished are not offers. If you are unable to quote, please so indicate on this form and return it. This request does not commit the Government to pay any costs incurred in the preparation of the submission of this quotation or to contract for supplies or services. Supplies are of domestic origin unless otherwise indicated by quoter. Any representations and/or certifications attached to this Request for Quotations must be completed by the quoter.

11. SCHEDULE (Include applicable Federal, State and local taxes)

ITEM NO.

(a)

SUPPLIES/SERVICES

(b)

QUANTITY

(c)

UNIT

(d)

UNIT PRICE

(e)

AMOUNT

(f)

“See Continuation Page”

NOTE: Additional provisions and representations are are not attached.

a. NAME OF QUOTER

75D30124Q78087

Subject: Focused Antibody and DNA Production for CVV Investigation

Solicitation Number: 75D30124Q78087

ISSUANCE DATE: August 2, 2024

QUESTIONS DUE DATE/TIME: August 13, 2024 by 5:00 PM EDT

Response DUE Date/time: August 21, 2024 by 5:00 PM EDT

Section A – Description

This is a combined synopsis/solicitation for commercial items prepared in accordance with the format in Subpart 12.6, as supplemented with additional information included in this notice. This announcement constitutes the only solicitation; proposals are being requested and a written solicitation will not be issued.

The solicitation number for this requirement is 75D30124Q78087 and is hereby issued as a Request for Quote (RFQ). The solicitation document and incorporated provisions and clauses are those in effect through Federal Acquisition Circular FAC 2024-05 dated May 22, 2024.

The associated North American Industrial Classification System (NAICS) code for this procurement is 325414 – Biological Product (except Diagnostic) Manufacturing with a Standard Size of 1,250 employees.

This is a RFQ for the procurement of Focused Antibody and DNA Production for CVV Investigation. The Government intends to award a Firm-Fixed Price (FFP) contract as a result of this solicitation that will include the terms and conditions that are set forth herein.

The provision at 52.212-1, Instructions to Offerors-Commercial, applies to this acquisition along with the addenda to the provision included in the solicitation document. FAR 52.212-2, Evaluation-Commercial Items, is not included.

Offerors shall include a completed copy of the provision at 52.212-3, Offeror Representations and Certifications-Commercial Items, with its offer or indicate if it is available online at SAM.gov. FAR 52.212-4, Contract Terms and Conditions-Commercial Items, applies to this acquisition; there are no addenda to the clause. FAR 52.212-5, Contract Terms and Conditions Required To Implement Statutes or Executive Orders-Commercial Items, applies to this acquisition and the additional FAR clauses cited in the clause that are applicable have been noted.

There are no additional contract requirement(s) or terms and conditions determined by the contracting officer to be necessary for this acquisition and consistent with customary commercial practices. No telephonic quotes will be processed. All responses must be received no later than the date stated above. Contact Jennifer Gartzke, Contract Specialist, at xuy7@cdc.gov for any questions regarding this solicitation. Questions must be submitted in writing; no telephonic questions will be entertained.

SECTION B – SUPPLIES OR SERVICES AND PRICES

Line Items

PURCHASE ORDER TOTAL: ______________________

SECTION C – STATEMENT OF WORK

Statement of Work Title: Focused Antibody and DNA Production for CVV Investigation

SECTION 1 – BACKGROUND

CDC Influenza Division (ID) is responsible for the development of Candidate Vaccine Viruses (CVV) based on circulating and novel influenza strains. CVVs are reassortant viruses which are used as the starting materials for seasonal and pandemic vaccines. To facilitate the development of CVVs, the CDC uses synthetic genes to transcribe viral genes to produce CVVs. Interactions between viruses and host proteins can elucidate molecular properties of viruses not readily apparent by other means. Expressing proteins from engineered plasmids is the foundation of most downstream assays utilized in this regard.

Accordingly, the Influenza Division requires synthetic genes, produced by de novo synthesis or modifications of existing templates through mutagenesis, and other genetic products to be developed routinely based on the constant changes in the genetic makeup of the circulating and novel viruses. These changes are unpredictable and cannot be identified until the viruses are isolated from patients or infected animals.

SUBSECTION A – Definitions

1. Recombinant Protein: A recombinant protein is a protein that is derived from recombinant DNA technology, where a DNA sequence coding for the protein is inserted into a plasmid, which is then introduced into a host organism (often a bacterium or yeast) to produce the protein.

2. Recombinant Antibody: A recombinant antibody is an antibody that is produced through recombinant DNA technology. The genes that encode the antibody are inserted into a vector, which is then expressed in a host organism, producing the antibody. Technically, it is a specialized form of recombinant protein, but it often requires expertise and equipment specific to the creation of recombinant antibodies.

3. V(D)J Segments: Segments can be interchanged with “regions” in most cases in the literature, but either way, within the scope here, we refer to the variable (V), diversity (D), and joining (J) gene segments of the immune system's B- and T-cell receptors. This terminology primarily comes into play in the context of adaptive immunity, where these gene segments undergo a process called V(D)J recombination to generate a diverse array of antibodies (in B cells) and T-cell receptors (in T cells).

a. Variable (V) region: These are gene segments that contribute to the variability of the receptor's antigen-binding site.

b. Diversity (D) region: These segments further contribute to the receptor's diversity but are only present in some types of immune receptors (like heavy chains of antibodies and beta and delta chains of T-cell receptors).

c. Joining (J) region: These segments link (or "join") the V and (when present) D regions together during recombination.

4. Candidate Vaccine Virus (CVV): An engineered or wild-type virus used to manufacture or develop vaccines created within regulated environments.

5. Plasmid: A plasmid is a small, circular, double-stranded DNA molecule that is distinct from a cell's chromosomal DNA. Plasmids are widely used in molecular biology as a tool for creating genetically modified organisms, specifically in the creation of recombinant viruses (including CVVs).

6. Base pair (bp): A base pair refers to the complementary pairing of two nucleotides in a double-stranded DNA or RNA molecule. When purchasing gene products (plasmids, gene fragments, etc.) commercially, they are often priced based on the “length” or number of base pairs in sequence.

7. Turnaround time (TAT): For the purposes of the proposed work, TAT is defined as when the Government sends digital sequences to receipt of deliverable or, for urgent mutagenesis, from when the vendor receives the plasmid and the request has been sent to the vendor to when the Government receives mutants.

8. Circular RNA (cRNA) is a type of RNA molecule that forms a closed-loop structure, in contrast to the linear structure of most other RNA molecules. The absence of free ends characterizes it, as the 5' and 3' ends are covalently linked together. Circular RNAs are found in various organisms, including humans, and have been shown to play important roles in gene regulation and cellular processes. Circular RNA (cRNA) has emerged as a potential alternative to linear messenger RNA (mRNA) for use in vaccine development due to its unique structural properties. The covalently closed loop structure of cRNA provides increased stability and resistance to degradation by exonucleases, which are enzymes that degrade RNA from the ends. This enhanced stability means that cRNA can persist longer within cells compared to linear mRNA.

SECTION 2 – PURPOSE/OBJECTIVE

The overall objective is to provide the Influenza Division with custom genetic products and antibodies for research regarding virus-host interactions and CVV characterization.

The Vaccine Preparedness Team of the Virology, from the Virology Surveillance and Diagnosis Branch within the Influenza Division of the CDC, shall be the principal scientific and technical party representing the Government’s needs, working with the Contractor .

The CDC will provide specific sequences digitally for each requested genetic product or antibody of the appropriate size.

SECTION 3 – SCOPE OF WORK

The scope of the project involves the production and delivery of various genetic constructs and products to support the CDC's influenza pandemic preparedness and response efforts. The overarching goal is to facilitate the characterization of potential vaccines and CVVs by providing the necessary tools for evaluating vaccine responses to engineered mutations in viral proteins.

In non-technical terms, the work includes:

1. Recombinant Antibody Production: Creating specific antibodies in a laboratory setting using provided genetic sequences. These antibodies are essential for testing how well different vaccines work against influenza.

2. Gene Synthesis and Cloning: Build custom genes based on digital sequences supplied by the CDC and insert them into plasmids (small DNA molecules) so they can be replicated and used for further study or vaccine development.

3. Mutagenesis: Introducing changes into these genes to mimic different mutations that might occur in influenza viruses, allowing researchers to test how these changes could affect vaccine effectiveness.

4. Plasmid Scale-Up: Producing larger quantities of these plasmids with high purity ensures they meet quality standards suitable for experiment use.

5. Glycerol Stock Creation: Making long-term storage forms of these plasmids so they can be preserved and used as needed without having to recreate them from scratch each time.

6. Circular RNA Synthesis: Generating circular RNA constructs that could serve as more stable alternatives to traditional mRNA for vaccine development.

Notable project requirements include:

· Timely delivery of batches of recombinant antibodies within 25 business days of ordering.

· Synthesis of complex genes within a 15-business days of ordering.

· High-quality products that meet specified endotoxin levels and concentration requirements and demonstrate stability through quality control tests.

· The project has specific objectives regarding quantity (e.g., 75 recombinant antibody preparations), quality (e.g., less than 0.01 EU/µg endotoxin), turnaround time (e.g., 25 business days for antibody delivery), and other performance metrics like purity assessment methods.

Contractor responsibilities are gene synthesis, vector construction, expression in mammalian culture systems, cloning, mutagenesis, scale-up production of plasmids at specified purities and concentrations, creation of glycerol stocks, cRNA synthesis with associated quality control tests—all while adhering to defined timelines.

SECTION 4 – TASKS TO BE PERFORMED

Independently, and not as an agent of the Government, the Contractor shall provide all necessary personnel, facilities, supplies and services (except for those to be furnished by the Government as specified elsewhere in the contract agreement) to perform the work required by this statement of work.

Task 1: 75 screen-scale preparations of recombinant antibodies expressed in a 200mL culture:

1. The CDC will provide a digital sequence.

2. Contractor shall perform gene synthesis and vector construction.

3. Each expression shall be done in a mammalian liquid culture with a volume of 200 mL.

4. Multiple antibodies will be requested at once, totaling 75 over one year, with batch sizes in the 10-20 range.

5. Delivery of recombinant antibodies (batches) within 25 days of request. (TAT is 25 business days).

Task 2: 4ug-scale synthesis of multiple custom complex genes cloned in standard plasmid vectors, provided by the Government, to a total of 42,800 base pairs across all genes:

1. The CDC will provide a digital sequence.

2. Representative sequences are provided below as “Example Gene 1” and “Example Gene 2.

3. TAT is 15 business days or less from date of order.

Task 3: Cloning in any of the products synthesized in Task 2 into plasmid vectors selected by CDC, up to 50 cloned plasmids:

1. CDC will supply plasmid vectors.

2. CDC will provide target restriction sites; if no target restriction sites are provided, sites may be used by the vendor’s choosing, so long as the 3’ and 5’ sites differ.

3. TAT is two additional business days or less after the completion of synthesis (Task 2) for that plasmid (17 business days from date of order).

Task 4: Rapid mutagenesis of the same synthetic genes, or from plasmids provided by the CDC, up to 160 mutants:

1. CDC will supply plasmid vectors.

2. Mutants are expected to derive mainly from plasmids derived from Task 2; however, the CDC may ship plasmids to be mutated to the vendor.

3. TAT is seven additional business days or less (in addition to the original 15 business days).

Task 5: Provide additional plasmid DNA product at 200μg/plasmid/preparation scale of plasmids produced from Tasks 2, 3, or 4, up to 50 plasmid preparations:

1. Plasmid shall be of transfection grade or equivalent, with a stated lower endotoxin guarantee of less than 0.01 EU/µg.

2. Plasmid preparation should be of high-quality DNA, showing little in the way of nicks and demonstrating greater than 90% of the population in a supercoiled state.

3. TAT is eight or less business days from the request, presuming the plasmid is available from Tasks 2, 3, or 4; or five business days from plasmid availability if included in the original request.

a. Delivery of additional plasmid preparations should not delay the delivery of products from Tasks 2, 3, or 4, and if they cannot be completed on the same day, they should be shipped separately.

Task 6: Provide additional plasmid DNA product at 1mg/plasmid/preparation scale of plasmids produced from Tasks 2, 3, or 4, up to five plasmid preparations:

1. Plasmid shall be of transfection grade or equivalent, with a stated lower endotoxin guarantee of less than 0.01 EU/µg.

2. Plasmid preparation should be of high-quality DNA, showing little in the way of nicks and demonstrating greater than 90% of the population in a supercoiled state.

3. TAT is eight or less business days from the request, assuming the plasmid is available from Tasks 2, 3, or 4; or five business days from plasmid availability if included in the original request.

a. The delivery of additional plasmid preparations should not delay the delivery of products from Tasks 2, 3, or 4. If they cannot be completed on the same day, they should be shipped separately.

Task 7: Glycerol stocks for any of the plasmids produced by this requirement by request, up to 160 stocks:

1. Stocks may be in the bacteria or yeast of the Contractor’s choosing, so long as the species and growth requirements, including media and antibiotics resistances, are communicated by email to the SME before delivery.

2. At a minimum, stocks must be shown to contain the intended plasmid via restriction digest, but a preference is given for sequence-confirmed glycerol stocks.

3. TAT is eight or fewer business days from the request, assuming the plasmid is available, or five business days from plasmid availability if it was included in the original request.

a. The delivery of additional plasmid preparations should not delay the delivery of products from Tasks 2, 3, or 4. If they cannot be completed on the same day, they should be shipped separately.

Task 8: Circular RNA (cRNA) synthesis, preparation, and purification of up to eight constructs:

1. It is understood that there are multiple technical methods to synthesize cRNA, and a preference is not given to any particular production method, however:

a. Should the method require synthesis and preparation of the plasmid, these costs are expected to be included as part of this Task unless the plasmid was previously produced in Tasks 2-6. For plasmids that have been previously synthesized, it is assumed that only a plasmid preparation should be performed for this task.

2. Length and deliverable yield may vary but are expected to resemble Example Gene 1

a. Yield is expected to be in the 1mg scale, though it is understood this may be produced fractionally.

b. Lengths are suspected to be between 2,000-3,500 nucleotides pending currently circulating influenza strains and vaccine design.

3. Concentration shall be adjusted to a flat 1mg/mL

a. Preferred buffer is 1mM Sodium Citrate, though other near-neutral buffers may be substituted with notice emailed to SME before delivery.

b. Vendor shall aliquote into uniform volume aliquots, targeting four aliquots per final preparation.

4. Regardless of production method, quality control tests for the delivered mRNA shall include, at minimum, results for:

a. Expected identity appearance and length via agarose gel

b. RNA concentration confirmation (post-normalization retesting required)

c. pH

d. RNaseR degradation test

e. Purity demonstrated by both A260/280 ratio and HPLC

5. TAT is 35 business days or less

SECTION 5 – GOVERNMENT-FURNISHED PROPERTY

The Government will provide genetic sequences to produce acceptable gene products and antibodies. The Government will provide additional plasmids or gene products to serve as templates or components for all tasks that derive from an existing plasmid (Tasks 3-8).

SECTION 6 – PLACE OF PERFORMANCE AND CONTRACT SUPPORT HOURS

SUBSECTION A – PLACE OF PERFORMANCE

Work will be conducted entirely at the Contractor’s facility.

SECTION 7 – TRAVEL

No travel is allowed for this award.

SECTION 8 – DELIVERABLES/REPORTING SCHEDULE

A. Reporting Schedule

1. The CDC project officer will place orders for plasmid products per the Schedule of Deliverables table below (subsection B).

2. All shipments under this contract shall be accompanied by packing slips that shall contain the following minimum information:

(a) Name of supplier

(b) Contract number

(c) Date of purchase

(d) Date of delivery or shipment

(e) Purchase number

(f) Itemized list of supplies, including quantity and length of each item

(g) Industry Standard Quality Assurance documentation, including sequence, yield, and purity

Shipping Address:

TBD

B. Schedule of Deliverables

SECTION 9 – REFERENCE MATERIALS

Example Gene 1:

CCGGAGTACTGGTCGACCTCCGAAGTTGGGGGGGAGCAAAAGCAGGGGATACAAAATGAACACTCAAATCCTGATATTCGCTCTGATTGCGATCATTCCAACAAATGCAGACAAAATCTGCCTCGGACATCATTCCGTGTCAAACGGAACCAAAGTAAACACATTAACTGAAAAAGGAGTGGAAGTCGTCAATGCAACCGAAACAGTGGAACGAACAAACACCCCCAGGATCTGCTCGAAAGGGAAAAAGACAGTTGACCTCGGTCAATGTGGACTCCTGGGGACAATCACCGGACCACCTCAATGTGACCAATTCCTAAAATTTTCAGCCGATTTAATTGTTGAGAGGCGAGAAGGAAGTGATGTCTGTTACCCTGGAAAATTCGTGAATGAAGAAGCTCTGAGGCAAATTCTCAGAGAATCAGGCGGAATTGACAAGGAACCCATGAGATTCGAATACAATGGAATAAGAACTAATGGGACGACCAGTGCATGTAGGAGATCAGGACCTTCATTCTATGCAGAAATGAAATGGCTCCTGTCAAACACAGATAATGCTACATTCCCGCAGATGACTAAGTCATATAAAAATACAAGAGAAAGCCCAGCTATAGTAGTATGGGGAATCCATCATTCCGTTTCAACTGCAGAGCAAACCAGGCTATATGGGAGTGGAAACAAACTGGTGACAGTTGGGAGTTCTAATTATCAACAATCTTTCGTACCGAGTCCAGGAGCAAGACCACAAGTTAATGGTCAATCTGGAAGAATTGACTTTCATTGGCTAATACTAAATCCCAATGATACAGTCACTTTCAGTTTCAATGGGGCTTTCATAGCTCCAGATCGTGCAAGCTTCCTGAGAGGGAAATCTATGGGAATCCAGAGTGGAGTACAGGTTGATGCCAATTGTGAAGGGGACTGCTATCATAGTGGAGGGACAATAATAAGTAACTTGCCATTTCAGAACATAGATAGCAGGGCAGTTGGAAAATGTCCGAGATATGTTAGGCAAAGGAGTCTTCTGCTGGCAACAGGGATGAAGAATGTTCCTGAGGTTCCAAAGAGAAAACGGACTGCGAGAGGCCTATTTGGTGCTATAGCGGGTTTCATTGAAAATGGGTGGGAAGGCCTAATTGATGGTTGGTATGGTTTCAGACATCAAAATGCACAGGGAGAGGGAACTGCTGCAGATTACAAAAGCACTCAATCGGCAATAGATCAAATAACAGGGAAATTAAACCGACTTATAGCGAAAACCAACCAACAATTTGAGTTGATAGACAATGAATTCAATGAGGTAGAAAAACAAATCGGTAATGTGATAAATTGGACCAGAGATTCTATGACAGAAGTATGGTCATACAATGCTGAATTCTTAGTGGCAATGGAGAACCAGCATACAATTGATCTGGCTGATTCAGAAATGAACAAACTGTATGAACGAGTGAAAAGACAGTTGAGAGAGAATGCTGAAGAAGACGGCACGGGTTGCTTTGAAATATTTCACAAGTGTGATGATGACTGTATGGCCAGTATTAGAAATAACACCTATGATCACAGAAAATACAGAGAAGAGGCAATGCAAAATAGAATACAGATTGACCCAGTCAAACTAAGCAGCGGCTACAAAGATGTGATACTTTGGTTTAGCTTCGGGGCATCATGTTTCACACTTCTAGCCATTGTAATGGGCCTTGTCTTCATATGTGTGAAGAATGGAAACATGCGGTGCACTATTTGTATATAAGTTTGGAAAAAACACCCTTGTTTCTACTAATAACCCGGCGGCCCAAAATGCCGACTCGGAGCGAAAGATATACCTCCCCCGGGGCCGGGAGGTCGCGTCACCGACCACGCCGCCGGCCCAGGCGACGCGCGACACGGACACCTGTCCCCAAAAACGCCACCATCGCAGCCACACACGGAGCGCCCGGGGCCCTCTGGTCAACCCCAGGACACACGCGGGAGCAGCGCCGGGCCGGGGACGCCCTCCCGGCCGCCCGTGCCACACGCAGGGGCCGGCCCGT

Example Gene 2:

CCGGAGTACTGGTCGACCTCCGAAGTTGGGGGGGAGCAAAAGCAGGGTCAAGATGAATCCAAACCAGAAGATTCTATGCACCTCAGCCACTGCTATCACAATAGGCGCAATCACAGTACTCATTGGAATAGCAAACATAGGACTGAACATAGGACTGCATCTAAAATTGGGCTGCAATTGCTCACGCTCACAACCTGAAACAACCAACACAAGCCAAACAACAATAAACAACTATTATAATGAAACAAACATCACCAACATCCAAATGAGAGAAAGAACAAGCAGGAATTTCAATAACTTAACTAAAGGGCTCTGTACTATAAATTCATGGCACATATATGGGAAAGACAACGCAGTAAGAATTGGAGAAAGCTCGGATGTTTTAGCCACAAGAGAACCCTATGTTTCATGCGACCCAGATGAATGCAAGTTCTATGCTCTCAGCCAAGGAACAACAATCAGAGGGAAACACTCAAACGGAACAATACACGATAGGTCCCAGTATCGTGCCCTGATAAGCTGGCCACTATCATCACCGCCCACAGTGTACAACAGCAGGGTGGAGTGCATCGGGTGGTCAAGTACTAGTTGCCATGATGGCAAATCCAGAATGTCAATATGTATATCAGGACCAAACAACAATGCATCTGCAGTAATATGGTACAACAGAAGGCCTGTTGCAGAAATTAACACATGGGCCCGAAACATACTAAGAACACAAGAATCTGAATGTGTATGCCACAACGGCGTATGCCCAGTAGTGTTCACCGATGGGCCTGCCACTGGACCTGCAGACACAAGAATATACTATTTTAAAGAGGGGAAAATATTGAAGTGGGAGTCTCTGACTGGAACTGCTAAGCATGTTGAAGAATGCTCATGTTACGGGAAACGAACAGGGATTACCTGCACATGCAGGGACAATTGGCAGGGCTCAAATAGACCAGTGATTCAGATAGACCCAGTAGCAATGACACACACTAGTCAATATATATGCAGTCCTGTCCTTACAGACAGTCCCCGACCGAATGACCCAAACATAGGTAAGTGTAATGACCCGTATCCAGGTAATAATAACAATGGAGTCAAGGGATTCTCATACCTGGATGGGGATAACACTTGGCTAGGGAGGACAATAAGCACAGCCTCGAGGTCTGGGTACGAGATGTTAAAAGTGCCAAATGCATTGACAGATGATAGATCAAAGCCCATCCAAGGTCAGACAATTGTATTAAACGCTGACTGGAGTGGTTACAGTGGGTCTTTCATGGACTATTGGGCTGAAGGGGACTGCTATCGAGCGTGTTTTTATGTGGAGCTGATACGTGGGAAACCCAAGGAGGGTAGAGTGTGGTGGACCAGCAATAGTATAGTATCGATGTGTTCCAGTACAGAATTCCTGGGACAATGGAACTGGCCTGACGGGGCTAAAATAGAGTACTTCCTCTAAGATGAAGAAAAAGACCCTTGTTTCTACTAATAACCCGGCGGCCCAAAATGCCGACTCGGAGCGAAAGATATACCTCCCCCGGGGCCGGGAGGTCGCGTCACCGACCACGCCGCCGGCCCAGGCGACGCGCGACACGGACACCTGTCCCCAAAAACGCCACCATCGCAGCCACACACGGAGCGCCCGGGGCCCTCTGGTCAACCCCAGGACACACGCGGGAGCAGCGCCGGGCCGGGGACGCCCTCCCGGCCGCCCGTGCCACACGCAGGGGCCGGCCCGT

SECTION 10 – MINIMUM VENDOR QUALIFICATIONS

1. Proven track record with cRNA Synthesis: Given the emerging nature of cRNA technology, vendors must demonstrate specific expertise and successful past performance in synthesizing circular RNAs (Task 8).

2. Ability to receive shipments of template plasmids from CDC.

3. Regulatory Compliance: Vendors shall comply with all relevant regulations and guidelines pertaining to genetic engineering work, including biosafety level requirements.

4. Scalability and Flexibility: Demonstrated capacity across a wide range of production yields while maintaining target timetables. Preference is given to those who can demonstrate success with difficult-to-clone influenza genes.

SECTION 11 – ADDITIONAL REQUIREMENTS

Kickoff Meeting A kickoff meeting will be scheduled virtually within 10 business days after contract award. The government attendess will include the COR, CO, and CS. Contractor shall prepare an agenda that will be sent to the COR and CO five days prior to the kickoff meeting via email. Contractor shall prepare a summary of the meeting that shall be sent via email to the COR and CO five days after meeting is held.

Information Security and Privacy The Contractor (and/or any subcontractor) shall not have access to, or host, and/or maintain any Government information system(s) in relation to the proposed work. All data will be provided via secured web portal or service (e.g., Amazon Web Services or FileShare). No sensitive data, patient information, or personally identifiable information will be provided to the Contractor on the basis of the proposed work.

Section 508 Compliance Electronic and Information Technology Accessibility

(a) Section 508 of the Rehabilitation Act of 1973 (29 U.S.C. 794d), as amended by the Workforce Investment Act of 1998 and the Architectural and Transportation Barriers Compliance Board Electronic and Information (EIT) Accessibility Standards (36 CFR part 1194), require that when Federal agencies develop, procure, maintain, or use electronic and information technology, Federal employees with disabilities have access to and use of information and data that is comparable to the access and use by Federal employees who are not individuals with disabilities, unless an undue burden would be imposed on the agency. Section 508 also requires that individuals with disabilities, who are members of the public seeking information or services from a Federal agency, have access to and use of information and data that is comparable to that provided to the public who are not individuals with disabilities, unless an undue burden would be imposed on the agency.

(b) Accordingly, any offeror responding to this solicitation must comply with established HHS EIT accessibility standards. Information about Section 508 is available at http://www.hhs.gov/web/508. The complete text of the Section 508 Final Provisions can be accessed at http://www.access-aboard.gov/sec508/standards.htm.

(c) The Section 508 accessibility standards applicable to this contract are: 1194.

205 WCAG 2.0 Level A & AA Success Criteria 302 Functional Performance Criteria 502 Inoperability with Assistive Technology 504 Authoring Tools 602 Support Documentation 603 Support Services In order to facilitate the Government's determination whether proposed EIT supplies meet applicable Section 508 accessibility standards, offerors must submit an HHS Section 508 Product Assessment Template, in accordance with its completion instructions. The purpose of the template is to assist HHS acquisition and program officials in determining whether proposed EIT supplies conform to applicable Section 508 accessibility standards. The template allows offerors or developers to self-evaluate their supplies and documentation detail - whether they conform to a specific Section 508 accessibility standard, and any underway remediation efforts addressing conformance issues. Instructions for preparing the HHS Section 508 Evaluation Template are available under Section 508 policy on the HHS Web site http://hhs.gov/web/508.

In order to facilitate the Government's determination whether proposed EIT services meet applicable Section 508 accessibility standards, offerors must provide enough information to assist the Government in determining that the EIT services conform to Section 508 accessibility standards, including any underway remediation efforts addressing conformance issues.

(d) Respondents to this solicitation must identify any exception to Section 508 requirements. If a offeror claims its supplies or services meet applicable Section 508 accessibility standards, and it is later determined by the Government, i.e., after award of a contract or order, that supplies or services delivered do not conform to the accessibility standards, remediation of the supplies or services to the level of conformance specified in the contract will be the responsibility of the Contractor at its expense.

(e) Electronic content must be accessible to HHS acceptance criteria. Checklist for various formats are available at http://508.hhs.gov/, or from the Section 508 Coordinator listed at https://www.hhs.gov/web/section-508/additional-resources/section-508-contacts/index.html. Materials that are final items for delivery should be accompanied by the appropriate checklist, except upon approval of the Contracting Officer or Representative.

(End of verbiage)

OTHER CONSIDERATIONS AND ADDITIONAL INFORMATION FOR OFFICE OF ACQUISITION SERVICES

SUBSECTION B – PROCUREMENT POINT OF CONTACT (POC) INFORMATION

COR/POC:

Shipping address for materials:

TBD

Contracting Officer Liubov Kriel 770.488.2856 lkriel@cdc.gov

Contract Specialist Jennifer Gartzke 404.498.0020 Xuy7@cdc.gov

SECTION D TERMS AND CONDITIONS

Clauses

Clauses Incorporated by Reference

52.204-12 Unique Entity Identifier Maintenance (OCT 2016) 52.204-13 System for Award Management Maintenance (OCT 2018) 52.204-18 Commercial and Government Entity Code Maintenance (AUG 2020) 52.204-19 Incorporation by Reference of Representations and Certifications (DEC 2014) 52.212-4 Contract Terms and Conditions—Commercial Products and Commercial Services (NOV 2023) 52.227-17 Rights in Data – Special Works (DEC 2007) 52.232-1 Payments (APR 1984) 52.232-39 Unenforceability of Unauthorized Obligations (JUN 2013) 52.233-1 Disputes (MAY 2014) 52.233-4 Applicable Law for Breach of Contract Claim (OCT 2004) 52.244-6 Subcontracts for Commercial Products and Commercial Services (FEB 2024) HHSAR Source 352.222-70 Contractor Cooperation in Equal Employment Opportunity Investigation

Clauses Incorporated by Full Text

52.252-2 Clauses Incorporated by Reference.

As prescribed in 52.107(b), insert the following clause:

Clauses Incorporated By Reference (Feb 1998) This contract incorporates one or more clauses by reference, with the same force and effect as if they were given in full text. Upon request, the Contracting Officer will make their full text available. Also, the full text of a clause may be accessed electronically at this/these address(es):

Home | Acquisition.GOV HHSAR | Acquisition.GOV (End of clause)

52.204-1 Approval of Contract (DEC 1989) This contract is subject to the written approval of Liubov Kriel and shall not be binding until so approved.

(End of clause)

52.212-5 Contract Terms and Conditions Required To Implement Statutes or Executive Orders—Commercial Products and Commercial Services (MAY 2024)

(a) The Contractor shall comply with the following Federal Acquisition Regulation (FAR) clauses, which are incorporated in this contract by reference, to implement provisions of law or Executive orders applicable to acquisitions of commercial products and commercial services:

(1) 52.203-19, Prohibition on Requiring Certain Internal Confidentiality Agreements or Statements (Jan 2017) (section 743 of Division E, Title VII, of the Consolidated and Further Continuing Appropriations Act, 2015 (Pub. L. 113-235) and its successor provisions in subsequent appropriations acts (and as extended in continuing resolutions)).

(2) 52.204-23, Prohibition on Contracting for Hardware, Software, and Services Developed or Provided by Kaspersky Lab Covered Entities (Dec 2023) (Section 1634 of Pub. L. 115-91).

(3) 52.204-25, Prohibition on Contracting for Certain Telecommunications and Video Surveillance Services or Equipment. (Nov 2021) (Section 889(a)(1)(A) of Pub. L. 115-232).

(4) 52.209-10, Prohibition on Contracting with Inverted Domestic Corporations (Nov 2015).

(5) 52.232-40, Providing Accelerated Payments to Small Business Subcontractors (Mar 2023) ( 31 U.S.C. 3903 and 10 U.S.C. 3801).

(6) 52.233-3, Protest After Award (Aug 1996) ( 31 U.S.C. 3553).

(7) 52.233-4, Applicable Law for Breach of Contract Claim (Oct 2004) (Public Laws 108-77 and 108-78 ( 19 U.S.C. 3805 note)).

(b) The Contractor shall comply with the FAR clauses in this paragraph (b) that the Contracting Officer has indicated as being incorporated in this contract by reference to implement provisions of law or Executive orders applicable to acquisitions of commercial products and commercial services:

[Contracting Officer check as appropriate.]

__ (1) 52.203-6, Restrictions on Subcontractor Sales to the Government (Jun 2020), with Alternate I (Nov 2021) ( 41 U.S.C. 4704 and 10 U.S.C. 4655).

__ (2) 52.203-13, Contractor Code of Business Ethics and Conduct (Nov 2021) ( 41 U.S.C. 3509)).

__ (3) 52.203-15, Whistleblower Protections under the American Recovery and Reinvestment Act of 2009 (Jun 2010) (Section 1553 of Pub. L. 111-5). (Applies to contracts funded by the American Recovery and Reinvestment Act of 2009.)

_X_ (4) 52.203-17, Contractor Employee Whistleblower Rights (Nov 2023) ( 41 U.S.C. 4712); this clause does not apply to contracts of DoD, NASA, the Coast Guard, or applicable elements of the intelligence community—see FAR 3.900(a).

_X_ (5) 52.204-10, Reporting Executive Compensation and First-Tier Subcontract Awards (Jun 2020) (Pub. L. 109-282) ( 31 U.S.C. 6101 note).

__ (6) [Reserved].

__ (7) 52.204-14, Service Contract Reporting Requirements (Oct 2016) (Pub. L. 111-117, section 743 of Div. C).

__ (8) 52.204-15, Service Contract Reporting Requirements for Indefinite-Delivery Contracts (Oct 2016) (Pub. L. 111-117, section 743 of Div. C).

_X_ (9) 52.204-27, Prohibition on a ByteDance Covered Application (Jun 2023) (Section 102 of Division R of Pub. L. 117-328).

__ (10) 52.204-28, Federal Acquisition Supply Chain Security Act Orders—Federal Supply Schedules, Governmentwide Acquisition Contracts, and Multi-Agency Contracts. (Dec 2023) ( Pub. L. 115–390, title II).

_X_ (11) (i) 52.204-30, Federal Acquisition Supply Chain Security Act Orders—Prohibition. (Dec 2023) ( Pub. L. 115–390, title II).

__ (ii) Alternate I (Dec 2023) of 52.204-30.

_X_ (12) 52.209-6, Protecting the Government’s Interest When Subcontracting with Contractors Debarred, Suspended, or Proposed for Debarment. (Nov 2021) ( 31 U.S.C. 6101 note).

_X_ (13) 52.209-9, Updates of Publicly Available Information Regarding Responsibility Matters (Oct 2018) ( 41 U.S.C. 2313).

__ (14) [Reserved].

__ (15) 52.219-3, Notice of HUBZone Set-Aside or Sole-Source Award (Oct 2022) ( 15 U.S.C. 657a).

__ (16) 52.219-4, Notice of Price Evaluation Preference for HUBZone Small Business Concerns (Oct 2022) (if the offeror elects to waive the preference, it shall so indicate in its offer) ( 15 U.S.C. 657a).

__ (17) [Reserved] __ (18) (i) 52.219-6, Notice of Total Small Business Set-Aside (Nov 2020) ( 15 U.S.C. 644).

__ (ii) Alternate I (Mar 2020) of 52.219-6.

__ (19) (i) 52.219-7, Notice of Partial Small Business Set-Aside (Nov 2020) ( 15 U.S.C. 644).

__ (ii) Alternate I (Mar 2020) of 52.219-7.

__ (20) 52.219-8, Utilization of Small Business Concerns (Feb 2024) ( 15 U.S.C. 637(d)(2) and (3)).

__ (21) (i) 52.219-9, Small Business Subcontracting Plan (Sep 2023) ( 15 U.S.C. 637(d)(4)).

__ (ii) Alternate I (Nov 2016) of 52.219-9.

__ (iii) Alternate II (Nov 2016) of 52.219-9.

__ (iv) Alternate III (Jun 2020) of 52.219-9.

__ (v) Alternate IV (Sep 2023) of 52.219-9.

__ (22) (i) 52.219-13, Notice of Set-Aside of Orders (Mar 2020) ( 15 U.S.C. 644(r)).

__ (ii) Alternate I (Mar 2020) of 52.219-13.

__ (23) 52.219-14, Limitations on Subcontracting (Oct 2022) ( 15 U.S.C. 637s).

__ (24) 52.219-16, Liquidated Damages—Subcontracting Plan (Sep 2021) ( 15 U.S.C. 637(d)(4)(F)(i)).

__ (25) 52.219-27, Notice of Set-Aside for, or Sole-Source Award to, Service-Disabled Veteran-Owned Small Business (SDVOSB) Concerns Eligible Under the SDVOSB Program (Feb 2024) ( 15 U.S.C. 657f).

_X_ (26) (i) 52.219-28, Post Award Small Business Program Rerepresentation (Feb 2024) ( 15 U.S.C. 632(a)(2)).

__ (ii) Alternate I (Mar 2020) of 52.219-28.

__ (27) 52.219-29, Notice of Set-Aside for, or Sole-Source Award to, Economically Disadvantaged Women-Owned Small Business Concerns (Oct 2022) ( 15 U.S.C. 637(m)).

__ (28) 52.219-30, Notice of Set-Aside for, or Sole-Source Award to, Women-Owned Small Business Concerns Eligible Under the Women-Owned Small Business Program (Oct 2022) ( 15 U.S.C. 637(m)).

__ (29) 52.219-32, Orders Issued Directly Under Small Business Reserves (Mar 2020) ( 15 U.S.C. 644(r)).

__ (30) 52.219-33, Nonmanufacturer Rule (Sep 2021) ( 15U.S.C. 637(a)(17)).

_X_ (31) 52.222-3, Convict Labor (Jun 2003) (E.O.11755).

_X_ (32) 52.222-19, Child Labor-Cooperation with Authorities and Remedies (Feb 2024).

_X_ (33) 52.222-21, Prohibition of Segregated Facilities (Apr 2015).

_X_ (34) (i) 52.222-26, Equal Opportunity (Sep 2016) (E.O.11246).

__ (ii) Alternate I (Feb 1999) of 52.222-26.

_X_ (35) (i) 52.222-35, Equal Opportunity for Veterans (Jun 2020) ( 38 U.S.C. 4212).

__ (ii) Alternate I (Jul 2014) of 52.222-35.

_X_ (36) (i) 52.222-36, Equal Opportunity for Workers with Disabilities (Jun 2020) ( 29 U.S.C. 793).

__ (ii) Alternate I (Jul 2014) of 52.222-36.

_X_ (37) 52.222-37, Employment Reports on Veterans (Jun 2020) ( 38 U.S.C. 4212).

_X_ (38) 52.222-40, Notification of Employee Rights Under the National Labor Relations Act (Dec 2010) (E.O. 13496).

_X_ (39) (i) 52.222-50, Combating Trafficking in Persons (Nov 2021) ( 22 U.S.C. chapter 78 and E.O. 13627).

__ (ii) Alternate I (Mar 2015) of 52.222-50 ( 22 U.S.C. chapter 78 and E.O. 13627).

__ (40) 52.222-54, Employment Eligibility Verification (May 2022) (Executive Order 12989). (Not applicable to the acquisition of commercially available off-the-shelf items or certain other types of commercial products or commercial services as prescribed in FAR 22.1803.)

__ (41) (i) 52.223-9, Estimate of Percentage of Recovered Material Content for EPA–Designated Items (May 2008) ( 42 U.S.C. 6962(c)(3)(A)(ii)). (Not applicable to the acquisition of commercially available off-the-shelf items.)

__ (ii) Alternate I (May 2008) of 52.223-9 ( 42 U.S.C. 6962(i)(2)(C)). (Not applicable to the acquisition of commercially available off-the-shelf items.)

__ (42) 52.223-11, Ozone-Depleting Substances and High Global Warming Potential Hydrofluorocarbons (May 2024) ( 42 U.S.C. 7671, et seq.).

__ (43) 52.223-12, Maintenance, Service, Repair, or Disposal of Refrigeration Equipment and Air Conditioners (May 2024) ( 42 U.S.C. 7671, et seq.).

__ (44) 52.223-20, Aerosols (May 2024) ( 42 U.S.C. 7671, et seq.).

__ (45) 52.223-21, Foams (May 2024) ( 42 U.S.C. 7671, et seq.).

__ (46) 52.223-23, Sustainable Products and Services (May 2024) ( E.O. 14057, 7 U.S.C. 8102, 42 U.S.C. 6962, 42 U.S.C. 8259b, and 42 U.S.C. 7671l).

__ (47) (i) 52.224-3 Privacy Training (Jan 2017) (5 U.S.C. 552 a).

__ (ii) Alternate I (Jan 2017) of 52.224-3.

_X_ (48) (i) 52.225-1, Buy American-Supplies (Oct 2022) ( 41 U.S.C. chapter 83).

__ (ii) Alternate I (Oct 2022) of 52.225-1.

__ (49) (i) 52.225-3, Buy American-Free Trade Agreements-Israeli Trade Act (NOV 2023) ( 19 U.S.C. 3301 note, 19 U.S.C. 2112 note, 19 U.S.C. 3805 note, 19 U.S.C. 4001 note, 19 U.S.C. chapter 29 (sections 4501-4732), Public Law 103-182, 108-77, 108-78, 108-286, 108-302, 109-53, 109-169, 109-283, 110-138, 112-41, 112-42, and 112-43.

__ (ii) Alternate I [Reserved].

__ (iii) Alternate II (Dec 2022) of 52.225-3.

__ (iv) Alternate III (Feb 2024) of 52.225-3.

__ (v) Alternate IV (Oct 2022) of 52.225-3.

__ (50) 52.225-5, Trade Agreements (NOV 2023) ( 19 U.S.C. 2501, et seq., 19 U.S.C. 3301 note).

__ (51) 52.225-13, Restrictions on Certain Foreign Purchases (Feb 2021) (E.O.’s, proclamations, and statutes administered by the Office of Foreign Assets Control of the Department of the Treasury).

__ (52) 52.225-26, Contractors Performing Private Security Functions Outside the United States (Oct 2016) (Section 862, as amended, of the National Defense Authorization Act for Fiscal Year 2008; 10 U.S.C. Subtitle A, Part V, Subpart G Note).

__ (53) 52.226-4, Notice of Disaster or Emergency Area Set-Aside (Nov 2007) ( 42 U.S.C. 5150).

__ (54) 52.226-5, Restrictions on Subcontracting Outside Disaster or Emergency Area (Nov 2007) ( 42 U.S.C. 5150).

_X_ (55) 52.226-8, Encouraging Contractor Policies to Ban Text Messaging While Driving (May 2024) ( E.O. 13513).

__ (56) 52.229-12, Tax on Certain Foreign Procurements (Feb 2021).

__ (57) 52.232-29, Terms for Financing of Purchases of Commercial Products and Commercial Services (Nov 2021) ( 41 U.S.C. 4505, 10 U.S.C. 3805).

__ (58) 52.232-30, Installment Payments for Commercial Products and Commercial Services (Nov 2021) ( 41 U.S.C. 4505, 10 U.S.C. 3805).

_X_ (59) 52.232-33, Payment by Electronic Funds Transfer-System for Award Management (Oct2018) ( 31 U.S.C. 3332).

__ (60) 52.232-34, Payment by Electronic Funds Transfer-Other than System for Award Management (Jul 2013) ( 31 U.S.C. 3332).

__ (61) 52.232-36, Payment by Third Party (May 2014) ( 31 U.S.C. 3332).

__ (62) 52.239-1, Privacy or Security Safeguards (Aug 1996) ( 5 U.S.C. 552a).

__ (63) 52.242-5, Payments to Small Business Subcontractors (Jan 2017) ( 15 U.S.C. 637(d)(13)).

__ (64) (i) 52.247-64, Preference for Privately Owned U.S.-Flag Commercial Vessels (Nov 2021) ( 46 U.S.C. 55305 and 10 U.S.C. 2631).

__ (ii) Alternate I (Apr 2003) of 52.247-64.

__ (iii) Alternate II (Nov 2021) of 52.247-64.

(c) The Contractor shall comply with the FAR clauses in this paragraph (c), applicable to commercial services, that the Contracting Officer has indicated as being incorporated in this contract by reference to implement provisions of law or Executive orders applicable to acquisitions of commercial products and commercial services:

[Contracting Officer check as appropriate.] __ (1) 52.222-41, Service Contract Labor Standards (Aug 2018) ( 41 U.S.C. chapter67).

__ (2) 52.222-42, Statement of Equivalent Rates for Federal Hires (May 2014) ( 29 U.S.C. 206 and 41 U.S.C. chapter 67).

__ (3) 52.222-43, Fair Labor Standards Act and Service Contract Labor Standards-Price Adjustment (Multiple Year and Option Contracts) (Aug 2018) ( 29 U.S.C. 206 and 41 U.S.C. chapter 67).

__ (4) 52.222-44, Fair Labor Standards Act and Service Contract Labor Standards-Price Adjustment (May 2014) ( 29U.S.C.206 and 41 U.S.C. chapter 67).

__ (5) 52.222-51, Exemption from Application of the Service Contract Labor Standards to Contracts for Maintenance, Calibration, or Repair of Certain Equipment-Requirements (May 2014) ( 41 U.S.C. chapter 67).

__ (6) 52.222-53, Exemption from Application of the Service Contract Labor Standards to Contracts for Certain Services-Requirements (May 2014) ( 41 U.S.C. chapter 67).

__ (7) 52.222-55, Minimum Wages for Contractor Workers Under Executive Order 14026 (Jan 2022).

__ (8) 52.222-62, Paid Sick Leave Under Executive Order 13706 (Jan 2022) (E.O. 13706).

__ (9) 52.226-6, Promoting Excess Food Donation to Nonprofit Organizations (Jun 2020) ( 42 U.S.C. 1792).

(d) Comptroller General Examination of Record. The Contractor shall comply with the provisions of this paragraph (d) if this contract was awarded using other than sealed bid, is in excess of the simplified acquisition threshold, as defined in FAR 2.101, on the date of award of this contract, and does not contain the clause at 52.215-2, Audit and Records-Negotiation.

(1) The Comptroller General of the United States, or an authorized representative of the Comptroller General, shall have access to and right to examine any of the Contractor’s directly pertinent records involving transactions related to this contract.

(2) The Contractor shall make available at its offices at all reasonable times the records, materials, and other evidence for examination, audit, or reproduction, until 3 years after final payment under this contract or for any shorter period specified in FAR subpart 4.7, Contractor Records Retention, of the other clauses of this contract. If this contract is completely or partially terminated, the records relating to the work terminated shall be made available for 3 years after any resulting final termination settlement. Records relating to appeals under the disputes clause or to litigation or the settlement of claims arising under or relating to this contract shall be made available until such appeals, litigation, or claims are finally resolved.

(3) As used in this clause, records include books, documents, accounting procedures and practices, and other data, regardless of type and regardless of form. This does not require the Contractor to create or maintain any record that the Contractor does not maintain in the ordinary course of business or pursuant to a provision of law.

(e)

(1) Notwithstanding the requirements of the clauses in paragraphs (a), (b), (c), and (d) of this clause, the Contractor is not required to flow down any FAR clause, other than those in this paragraph (e)(1), in a subcontract for commercial products or commercial services. Unless otherwise indicated below, the extent of the flow down shall be as required by the clause-

(i) 52.203-13, Contractor Code of Business Ethics and Conduct (Nov 2021) ( 41 U.S.C. 3509).

(ii) 52.203-17, Contractor Employee Whistleblower Rights (Nov 2023) ( 41 U.S.C. 4712).

(iii) 52.203-19, Prohibition on Requiring Certain Internal Confidentiality Agreements or Statements (Jan 2017) (section 743 of Division E, Title VII, of the Consolidated and Further Continuing Appropriations Act, 2015 (Pub. L. 113-235) and its successor provisions in subsequent appropriations acts (and as extended in continuing resolutions)).

(iv) 52.204-23, Prohibition on Contracting for Hardware, Software, and Services Developed or Provided by Kaspersky Lab Covered Entities (Dec 2023) (Section 1634 of Pub. L. 115-91).

(v) 52.204-25, Prohibition on Contracting for Certain Telecommunications and Video Surveillance Services or Equipment. (Nov 2021) (Section 889(a)(1)(A) of Pub. L. 115-232).

(vi) 52.204-27, Prohibition on a ByteDance Covered Application (Jun 2023) (Section 102 of Division R of Pub. L. 117-328).

(vii)

(A) 52.204–30, Federal Acquisition Supply Chain Security Act Orders—Prohibition. (Dec 2023) ( Pub. L. 115–390, title II).

(B) Alternate I (Dec 2023) of 52.204–30.

(viii) 52.219-8, Utilization of Small Business Concerns (Feb 2024) ( 15 U.S.C. 637(d)(2) and (3)), in all subcontracts that offer further subcontracting opportunities. If the subcontract (except subcontracts to small business concerns) exceeds the applicable threshold specified in FAR 19.702(a) on the date of subcontract award, the subcontractor must include 52.219-8 in lower tier subcontracts that offer subcontracting opportunities.

(ix) 52.222-21, Prohibition of Segregated Facilities (Apr 2015).

(x) 52.222-26, Equal Opportunity (Sep 2015) (E.O.11246).

(xi) 52.222-35, Equal Opportunity for Veterans (Jun 2020) ( 38 U.S.C. 4212).

(xii) 52.222-36, Equal Opportunity for Workers with Disabilities (Jun 2020) ( 29 U.S.C. 793).

(xiii) 52.222-37, Employment Reports on Veterans (Jun 2020) ( 38 U.S.C. 4212).

(xiv) 52.222-40, Notification of Employee Rights Under the National Labor Relations Act (Dec 2010) (E.O. 13496). Flow down required in accordance with paragraph (f) of FAR clause 52.222-40.

(xv) 52.222-41, Service Contract Labor Standards (Aug 2018) ( 41 U.S.C.