Contract A208_P4852301

Virginia Polytechnic Institute and State University has awarded a contract to Eurofins Genomics LLC, effective October 6, 2026. The contracting organization is located in Virginia. The contract involves the provision of specialized genomic products, specifically custom DNA oligonucleotide sequences (primers). Two line items are specified: a forward primer sequence (POWV F - 5' AGAATGGCCATGACAGACACAA 3') and a reverse primer sequence (POWV R - 5' ACATGTACCArATrGCCCTGCT 3'), each at a unit price of $0.26. Delivery is designated to Eastwood Gillian at a Virginia location (540-231-1862).

The contract represents a procurement of research-grade molecular biology reagents in support of Virginia Tech's operational requirements. With a cumulative value of zero dollars as currently documented, the contract award reflects a minimal transaction value based on the unit pricing and quantities specified. These oligonucleotide primers are standard research materials commonly utilized in polymerase chain reaction (PCR) and molecular biology applications. The deliverables are to be provided on an individual unit basis to the designated recipient within Virginia.