D. immitis CO1 F - AGTGTAGAGGGTCAGCCTGAGTTA and 3 more items

Eurofins Genomics LLC has been awarded a contract by Virginia Polytechnic Institute and State University (Virginia Tech) effective September 30, 2026. The contract pertains to the provision of oligonucleotide primers for molecular biology applications, specifically four distinct sequences targeting Dracunculus medinensis (D. immitis) genetic markers. The line items include two 16S ribosomal RNA primers and two cytochrome oxidase I (CO1) primers, each priced at $0.26 per unit, with delivery directed to Eastwood Gillian at a Virginia Tech facility (540-231-1862). The cumulative contract value is one dollar, reflecting the minimal financial scope of this procurement.

The contract award represents a research support service for Virginia Tech, likely supporting molecular diagnostic or taxonomic research initiatives. All four oligonucleotide sequences are to be delivered to a single point of contact within the institution, indicating a consolidated research project or laboratory requirement. Given the negligible contract value and the highly specialized nature of the line items, this award appears to represent a small-scale procurement for academic research purposes rather than a substantial commercial engagement.