oJDW 2715, ConfigurationID: 5841023 Product Number: VC00021 Product Description: DNA Oligos in Tubes…
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0490898
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $4.32
About this award
The University of Virginia awarded contract A207_PO-0490898 to Sigma-Aldrich Inc. on October 13, 2026, with a cumulative value of four dollars. The prime contractor will deliver DNA oligonucleotides in tube format to support the university's research operations in Virginia. The specific line item encompasses one unit of customized DNA oligos (product number VC00021) configured with a 24-base pair count, DESALT purification method, ambient shipping, and delivery to Athira Pillai at the university.
The contract represents a purchase order arrangement for molecular biology research supplies. The DNA oligonucleotide sequence specified is CTAGAACTGAGTGCGTAAGTGTAG, packaged in a single tube at a unit price of $4.32. No specific period of performance dates are provided in the contract documentation. Performance is to occur at the University of Virginia location in Virginia.
Line items
| Item | Total |
|---|---|
| oJDW 2715, ConfigurationID: 5841023 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Ambient sequence: CTAGAACTGAGTGCGTAAGTGTAG scale: 0.0250 UMO name: oJDW 2715 purification: DESALT tubes: 1 packageType: TUBE melt | $4.32 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0490898?
Contract A207_PO-0490898 was awarded to Sigma-Aldrich Inc by University of Virginia on October 13, 2026.
How much is contract A207_PO-0490898 worth?
Its cumulative value is $4.32.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award