63 NEW, ConfigurationID: 5838113 Product Number: VC00021 Product Description: DNA Oligos in Tubes… and 1 more item

The University of Virginia has awarded a purchase order (A207_PO-0490404) to Sigma-Aldrich Inc., effective October 10, 2026, for specialized laboratory reagents. The contract, valued at thirteen dollars, covers the supply of DNA oligonucleotides in tube format to be delivered to Tanner Jack Wherley. The scope of work encompasses two distinct line items: a 40 base count DNA oligo sequence (GGTGGTACGGGAATTATGGACAAAGACTGCGAAATGAAGC) and a 33 base count DNA oligo sequence (CGCTCAGCTGGAATTTCAGCCGCCCACCCAGAA), both processed with desalt purification and packaged in individual tubes for ambient shipment.

The deliverables are manufactured reagents with unit prices of $7.20 and $5.94 respectively, totaling the contract value. Both line items are designated as new products within Sigma-Aldrich's catalog and employ identical processing specifications, including 0.0250 scale sizing and standard tube packaging. As a purchase order executed by an educational institution in Virginia, this award represents a routine procurement of research-grade molecular biology materials for laboratory use.