A01: SW_mFcgr2b-AC sgRNA: Single gRNA, mod, 3 nmol, Tube:Target Sequence: UUGAGCACCUGGAUCCACGGFull… and 2 more items

Synthego Holdings Inc. received a contract award from the University of Virginia on October 7, 2026, under contract number A207_PO-0488639. The cumulative contract value is $158. While specific details regarding the products and services to be delivered are not provided in the available documentation, the contracting organization and awardee suggest the engagement may involve specialized scientific or molecular biology solutions, as Synthego Holdings Inc. operates in the life sciences sector.

Additional substantive details regarding the scope of work, period of performance, place of performance, and specific deliverables cannot be reasonably inferred from the limited information contained in this contract award notice. The University of Virginia, located in Virginia, serves as the contracting organization. To obtain comprehensive information regarding the products, services, and performance requirements under this contract, reference to the full contract documentation and statement of work would be necessary.