Contract A207_PO-0488456
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0488456
- Awardee
- Eurofins Genomics LLC
- Contracting organization
- University of Virginia
- Cumulative value
- $11.00
About this award
The University of Virginia awarded contract A207_PO-0488456 to Eurofins Genomics LLC on October 6, 2026, for the provision of synthetic oligonucleotide sequences. The contract, valued at eleven dollars, comprises two line items for salt-free, 25-base oligonucleotide strands to be delivered to Keena Seagle Thomas. The first line item consists of one forward-strand sequence (TCAGAGCTCGCCTGCGCCTGCTTC) priced at $5.28, while the second line item consists of one reverse-strand sequence (TCAGATATCGCGGCTTTTCGATTTGG) priced at $5.72.
The contract represents a routine procurement of molecular biology research materials by the University of Virginia's contracting organization. Eurofins Genomics LLC, the prime contractor, will fulfill this order in Virginia. No period of performance or place of performance distinct from the awarding organization is specified in the available contract documentation. The minimal contract value and modest order quantities indicate this is a small-scale, single-transaction procurement typical of academic research support services.
Line items
| Item | Total |
|---|---|
| 0108comp_fwd-TCAGAGCTCGCCTGCGCCTGCTTC ( 25S,SaltFree) | $5.28 |
| 0108comp_rev-TCAGATATCGCGGCTTTTCGATTTGG ( 25S,SaltFree) | $5.72 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0488456?
Contract A207_PO-0488456 was awarded to Eurofins Genomics LLC by University of Virginia on October 6, 2026.
How much is contract A207_PO-0488456 worth?
Its cumulative value is $11.00.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award