Name:G87-37 cyto tail… and 6 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0488291
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $159.76
About this award
The University of Virginia awarded contract A207_PO-0488291 to Integrated DNA Technologies Inc. on October 6, 2026, with a total cumulative value of $159.00. The prime contractor will deliver seven synthetic DNA oligonucleotide products to Jeffrey A. Romano at the University of Virginia. The line items include custom DNA sequences designated as G87-37 cyto tail, BRILL_Loop1_Overhangs, BRILL_Loop2_Overhangs, and four additional oligo sequences labeled 87-37-C-F, 87-37-C-R, 87-GS cyto tail-F, and 87-GS cyto tail-R.
The deliverables consist of synthesized DNA oligonucleotides in 25 nanomole quantities with standard desalting purification. Unit prices range from $3.22 to $45.00 per oligonucleotide, reflecting variations in sequence length and complexity. The ordering organization is the University of Virginia, a state institution in Virginia. All products are to be delivered to the specified recipient at the university. No specific contract performance period is documented in the award materials beyond the October 6, 2026 award date.
Line items
| Item | Total |
|---|---|
| Name:G87-37 cyto tail Sequence:CTGGATCCAATAATTTACTTTTTCATGTGTTGCAAGCCCTTCAGTCGCGCATTCATGGAATGTTGCTGCTGCTGCTGCGAGGAATGCATTCAAAAATCCTCCACAGTAACATCTGACGACAATGATAATGAGTACACCACCGAGCTTGAACTTTCTCCCTTTAGCACAATCCGGCGGGAAATGTCCACCTTTGCATCTGTCGGCACCCATTGCTAGGCGG | $45.00 |
| Name:BRILL_Loop1_Overhangs Sequence:TTCATCGACGGCATCCAGTGGCTGGGTATCGCTGCTGCTGCTGATTTAGAAGATAATTGGGAAACTTTAAATGATAATTTAAAAGTTATTGAAAAAGCTGATAATGCTGCTCAAGTTAAAGATGCTTTAACTAAAATGCGTGCTGCTGCTTTAGATGCTCAAAAAGCTACTCCTCCTAAATTAGAAGATAAATCTCCTGATTCTCCTGAAATGAA | $45.00 |
| Name:87-37-C-F Sequence:TAG GCG GCC GCT CGA G Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:16 | $3.22 |
| Name:BRILL_Loop2_Overhangs Sequence:AAAAGTTATTGAAAAAGCTGATAATGCTGCTCAAGTTAAAGATGCTTTAACTAAAATGCGTGCTGCTGCTTTAGATGCTCAAAAAGCTACTCCTCCTAAATTAGAAGATAAATCTCCTGATTCTCCTGAAATGAAAGATTTTCGTCATGGTTTTGATATTTTAGTTGGTCAAATTGATGATGCTTTAAAATTAGCTAATGAAGGTAAAGTTAAAG | $45.00 |
| Name:87-37-C-R Sequence:ACA CAT GAA AAA GTA AAT TAT TGG ATC CAG GC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:32 | $6.44 |
| Name:87-GS cyto tail-F Sequence:GCG GCA GCA GCT GAT AGG CGG CCG CTC GAG Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:30 | $6.04 |
| Name:87-GS cyto tail-R Sequence:CGC TGC TGC CGC CAC ACA TGA AAA AGT AAA TTA TTG GAT CCA GGC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:45 | $9.06 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0488291?
Contract A207_PO-0488291 was awarded to Integrated DNA Technologies Inc by University of Virginia on October 6, 2026.
How much is contract A207_PO-0488291 worth?
Its cumulative value is $159.76.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award