oJDW 2698, ConfigurationID: 5822429 Product Number: VC00021 Product Description: DNA Oligos in Tubes… and 7 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0487649
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $30.42
About this award
The University of Virginia awarded a contract to Sigma-Aldrich Inc. on October 3, 2026, for the procurement of synthetic DNA oligonucleotides. The contract, identified as A207_PO-0487649, carries a cumulative value of $30.00 and covers eight distinct DNA oligo products delivered to Athira Pillai. All products utilize the same base product number (VC00021) and feature desalted purification in tube packaging with ambient shipping.
The contract encompasses eight line items representing DNA oligonucleotides of varying base counts, ranging from 19 to 25 bases, with unit prices ranging from $3.42 to $4.50 per oligo. Each oligonucleotide is supplied in a single tube at a 0.025 micromole scale. The specific sequences for each oligo (designated oJDW 2698 through oJDW 2705) are detailed in the contract specifications. No specific period of performance or place of performance beyond the delivery recipient is indicated in the contract documentation provided.
Line items
| Item | Total |
|---|---|
| oJDW 2698, ConfigurationID: 5822429 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: AAGAGCGCCTTGACGATACA scale: 0.0250 UMO name: oJDW 2698 purification: DESALT tubes: 1 packageType: TUBE meltingT | $3.60 |
| oJDW 2699, ConfigurationID: 5822430 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 25 shipping: Ambient sequence: AATATCCAAGAGACAGGTTTCTCCA scale: 0.0250 UMO name: oJDW 2699 purification: DESALT tubes: 1 packageType: TUBE mel | $4.50 |
| oJDW 2700, ConfigurationID: 5822431 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: GCCTGTAAGGGCTGTGACAT scale: 0.0250 UMO name: oJDW 2700 purification: DESALT tubes: 1 packageType: TUBE meltingT | $3.60 |
| oJDW 2701, ConfigurationID: 5822432 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: AACTTTTCTGCTTCCGTGCG scale: 0.0250 UMO name: oJDW 2701 purification: DESALT tubes: 1 packageType: TUBE meltingT | $3.60 |
| oJDW 2702, ConfigurationID: 5822433 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 21 shipping: Ambient sequence: CTGCGACTTCAACAGCAACTC scale: 0.0250 UMO name: oJDW 2702 purification: DESALT tubes: 1 packageType: TUBE melting | $3.78 |
| oJDW 2703, ConfigurationID: 5822434 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Ambient sequence: TGCTCTTAAAAGTCAGGTTTCCCA scale: 0.0250 UMO name: oJDW 2703 purification: DESALT tubes: 1 packageType: TUBE melt | $4.32 |
| oJDW 2704, ConfigurationID: 5822435 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: ACGGGGCTAAAGTGCATCTC scale: 0.0250 UMO name: oJDW 2704 purification: DESALT tubes: 1 packageType: TUBE meltingT | $3.60 |
| oJDW 2705, ConfigurationID: 5822436 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 19 shipping: Ambient sequence: GACAGAGCGTACAGTGCGT scale: 0.0250 UMO name: oJDW 2705 purification: DESALT tubes: 1 packageType: TUBE meltingTe | $3.42 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0487649?
Contract A207_PO-0487649 was awarded to Sigma-Aldrich Inc by University of Virginia on October 3, 2026.
How much is contract A207_PO-0487649 worth?
Its cumulative value is $30.42.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award