Contract A207_PO-0486770
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0486770
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $90.00
About this award
University of Virginia awarded contract A207_PO-0486770 to Integrated DNA Technologies Inc effective October 1, 2026. The cumulative contract value is $90. While the specific products and services are not detailed in the contract documentation provided, Integrated DNA Technologies Inc specializes in synthetic biology products, molecular biology reagents, and related life sciences supplies. Based on the contractor's core business operations, the deliverables under this award likely involve molecular biology materials or services procured by the University of Virginia for research or educational purposes.
The place of performance and specific period of contract performance duration are not specified in the available documentation. The contract was awarded by the University of Virginia, a state institution located in Virginia. Given the minimal contract value of $90 and the October 1, 2026 award date, this appears to be a small-value purchase order for routine laboratory or research-related materials or services rather than a major procurement initiative.
Line items
| Item | Total |
|---|---|
| Name:CH256 RRE J Sequence:AAAAATTGAACCATTAGGAGACGCGATAGCACCCACCAGGGCAAAAAGGCGAGTGGTGGAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTGTATTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATAGCGCTGACGGTACAGGCCAGACAATTGTTGTCTGGTATAGTGCAACAGCAAAACAATTTGCTGAGAGCTATAGAGGCGCA | $45.00 |
| Name:CH256 Rev D Sequence:CGAAGCTAGTCGATTAGGCATCTCCCATGGCAGGAAGAAGCGGAGACAGCGACGAAGCGCTCCTCCAAGCAGTAAGGATCATCAAAATCCTCTACCAAAGCAACCCTTATCCCAAACCAGAGGGAACCCGACAGGCTCGGAAGAATCGAAGAAGAAGGTGGAGAGCCATACAGAAACAGATCCATTCGATTGGTGAACGGATTCTTAGCTCTTACCTGGGACGAC | $45.00 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0486770?
Contract A207_PO-0486770 was awarded to Integrated DNA Technologies Inc by University of Virginia on October 1, 2026.
How much is contract A207_PO-0486770 worth?
Its cumulative value is $90.00.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award