oJDW 2695, ConfigurationID: 5699578 Product Number: VC00021 Product Description: DNA Oligos in Tubes…
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0477339
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $5.22
About this award
The University of Virginia awarded contract A207_PO-0477339 to Sigma-Aldrich Inc on September 4, 2026, for the procurement of specialized laboratory reagents. The contract, valued at $5.00, encompasses a single line item for deoxyribonucleic acid (DNA) oligonucleotides supplied in tube format. The specific product ordered is identified as oJDW 2695 (Product Number VC00021), consisting of one tube containing a 29-base pair DNA sequence (ACCACAAGTTTATATTCAGTCATGCCTCC) at a 0.0250 scale with desalt-level purification. The unit price for this item is $5.22.
The ordered DNA oligos are designated for delivery to Athira Pillai at the University of Virginia, with ambient temperature shipping requirements. This procurement represents a routine purchase of molecular biology research materials through the University of Virginia's purchasing mechanisms. As a prime contractor award, Sigma-Aldrich Inc assumes full responsibility for fulfillment of the specified product delivery. No information regarding the contract performance period, annual value, or cumulative value beyond the stated $5.00 contract amount is provided in the available documentation.
Line items
| Item | Total |
|---|---|
| oJDW 2695, ConfigurationID: 5699578 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 29 shipping: Ambient sequence: ACCACAAGTTTATATTCAGTCATGCCTCC scale: 0.0250 UMO name: oJDW 2695 purification: DESALT tubes: 1 packageType: TUBE | $5.22 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0477339?
Contract A207_PO-0477339 was awarded to Sigma-Aldrich Inc by University of Virginia on September 4, 2026.
How much is contract A207_PO-0477339 worth?
Its cumulative value is $5.22.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award