Contract A207_PO-0477231

The University of Virginia awarded a contract to Eurofins Genomics LLC on September 4, 2026, for the provision of specialized genomic products. The prime contractor, Eurofins Genomics LLC, was engaged to deliver a synthesized DNA oligonucleotide sequence designated as a 3' arm R LN construct with the specified sequence GATTACGCCAAGCTCGTTATCGATTTCCTATGCAACCCGCTGAAAGAGATTGCAA in a salt-free formulation. The contract was awarded in Virginia and specifies delivery to Natalya V Olekhnovich. The total contract value is nine dollars.

The purchase order (A207_PO-0477231) consists of a single line item for one unit of the described oligonucleotide product at a unit price of $9.90. The contract documentation does not specify an annual value, period of performance, or county of performance. As a research and higher education institution, the University of Virginia likely required this genomic product for molecular biology research, diagnostic testing, or related scientific applications. The minimal contract value and single-unit quantity suggest this represents a discrete procurement fulfilling a specific technical requirement.