16S UniF 1047, ConfigurationID: 5693939 Product Number: VC00021 Product Description: DNA Oligos… and 3 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0476069
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $52.60
About this award
Sigma-Aldrich Inc has been awarded a contract by the University of Virginia effective September 2, 2026, with a cumulative value of fifty-two dollars. The contract is issued in the Commonwealth of Virginia and calls for the delivery of four distinct DNA oligonucleotide products, each supplied in individual tubes with deoxyribonucleic acid (DNA) oligos designated for ambient shipping. All line items are consigned to Rory C. Laman and comprise custom-synthesized DNA sequences with varying base pair counts ranging from 20 to 22 bases, including configurations designated 16S UniF 1047, ITS2-5, ITS5-2, and UniR1194 5.
The four ordered DNA oligonucleotide tubes employ DESALT purification methodology and are packaged individually, with unit prices ranging from thirteen to thirteen dollars and sixty cents per tube. The contract encompasses a total of four line items, each representing one unit of customized DNA oligo product with specified sequences for molecular biology applications. The contract documentation does not specify an explicit annual value or extended performance period beyond the award date of September 2, 2026.
Line items
| Item | Total |
|---|---|
| 16S UniF 1047, ConfigurationID: 5693939 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: GTGSTGCAYGGYTGTCGTCA scale: 0.0500 UMO name: 16S UniF 1047 purification: DESALT tubes: 1 packageType: TUBE | $13.00 |
| ITS2-5, ConfigurationID: 5693940 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: GCTGCGTTCTTCATCGATGC scale: 0.0500 UMO name: ITS2-5 purification: DESALT tubes: 1 packageType: TUBE meltingTempara | $13.00 |
| ITS5-2, ConfigurationID: 5693941 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: GGAAGTAAAAGTCGTAACAAGG scale: 0.0500 UMO name: ITS5-2 purification: DESALT tubes: 1 packageType: TUBE meltingTempa | $13.60 |
| UniR1194 5, ConfigurationID: 5693942 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: ACGTCRTCCMCACCTTCCTC scale: 0.0500 UMO name: UniR1194 5 purification: DESALT tubes: 1 packageType: TUBE meltin | $13.00 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0476069?
Contract A207_PO-0476069 was awarded to Sigma-Aldrich Inc by University of Virginia on September 2, 2026.
How much is contract A207_PO-0476069 worth?
Its cumulative value is $52.60.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award