Name:BRIL… and 2 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0473771
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $53.06
About this award
The University of Virginia has awarded contract A207_PO-0473771 to Integrated DNA Technologies Inc, effective August 27, 2026. The contract carries a cumulative value of $53.00. While specific details regarding the period of performance and places of performance are not provided in the available documentation, the contract represents a procurement by a Virginia-based higher education institution.
The contract documents do not specify the detailed scope of products or services to be delivered under this award. However, based on the awardee's core business operations, Integrated DNA Technologies Inc typically provides synthetic biology products and services, including oligonucleotides and related molecular biology reagents. Additional information regarding contract performance specifications, delivery timelines, and detailed service descriptions would require review of the complete procurement documentation.
Line items
| Item | Total |
|---|---|
| Name:BRIL Sequence:GCGGGCAGGGAGGATGTCACGCTGCTGCTGCTGATTTAGAAGATAATTGGGAAACTTTAAATGATAATTTAAAAGTTATTGAAAAAGCTGATAATGCTGCTCAAGTTAAAGATGCTTTAACTAAAATGCGTGCTGCTGCTTTAGATGCTCAAAAAGCTACTCCTCCTAAATTAGAAGATAAATCTCCTGATTCTCCTGAAATGAAAGATTTTCGTCATGGTTTTGATATTTT | $45.00 |
| Name:feob_bril_gib_rev Sequence:GTG ACA TCC TCC CTG CCC GC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 | $4.03 |
| Name:feob_bril_gib_fwd Sequence:CTG GTG CCA CGC GGT AGT GG Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 | $4.03 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0473771?
Contract A207_PO-0473771 was awarded to Integrated DNA Technologies Inc by University of Virginia on August 27, 2026.
How much is contract A207_PO-0473771 worth?
Its cumulative value is $53.06.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award