Contract A207_PO-0471831
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0471831
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $174.60
About this award
Integrated DNA Technologies Inc has been awarded a contract by the University of Virginia, a public institution located in Virginia, to deliver specialized DNA sequences for research purposes. The contract, identified as A207_PO-0471831, was executed on August 21, 2026, with a cumulative value of $174.60. The deliverables are designated for receipt by Yelena Peskova and consist of three distinct synthetic DNA sequence constructs.
The contract encompasses three line items: iMet-MARCKS-Xbp1 sequence (unit price $45.00), UBC12-Xbp1-120 sequence (unit price $64.80), and UBC12-Xbp1-140 sequence (unit price $64.80), with one unit of each item required under the agreement. These DNA sequences appear to be research-grade constructs utilizing protein expression elements, likely for molecular biology or biotechnology applications within the University of Virginia's research operations. All items are to be delivered to the same recipient, indicating a consolidated research project requirement.
Line items
| Item | Total |
|---|---|
| Name:iMet-MARCKS-Xbp1 Sequence:ACGTTGTAAAACGACGGCCAGTGAATTGACGCGTATTGGGATATCCCAATTGCGCGCCTAATACGACTCACTATAGGCCGCCACCATGGGTGCCCAGTTCTCCAAGACCGCAGCGAAGGATTACAAGGACCATGATGGAGATTACAAAGACCATGACATTGATTATAAGGACGATGATGACAAGGGAGAAGCCGCCGCGGAGAGGCCTGGGGAGGCGGCT | $45.00 |
| Name:UBC12-Xbp1-120 Sequence:ACGTTGTAAAACGACGGCCAGTGAATTGACGCGTATTGGGATATCCCAATTGCGCGCCTAATACGACTCACTATAGGCCGCCACCATGATCAAGCTGTTCTCGCTGAAGCAGCAGAAGAAGGAGGAGGAGTCGGCGGGCGGCACCAAGGGCAGCAGCAAGAAGGCGTCGGCGGCGCAGCTGCGGATCCAGAAGGACATAAACGAGCTGAACCTGCCCAAGAC | $64.80 |
| Name:UBC12-Xbp1-140 Sequence:ACGTTGTAAAACGACGGCCAGTGAATTGACGCGTATTGGGATATCCCAATTGCGCGCCTAATACGACTCACTATAGGCCGCCACCATGATCAAGCTGTTCTCGCTGAAGCAGCAGAAGAAGGAGGAGGAGTCGGCGGGCGGCACCAAGGGCAGCAGCAAGAAGGCGTCGGCGGCGCAGCTGCGGATCCAGAAGGACATAAACGAGCTGAACCTGCCCAAGAC | $64.80 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0471831?
Contract A207_PO-0471831 was awarded to Integrated DNA Technologies Inc by University of Virginia on August 21, 2026.
How much is contract A207_PO-0471831 worth?
Its cumulative value is $174.60.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award