O790 PROSER2AS1F, ConfigurationID: 5671147 Product Number: VC00021 Product Description: DNA Oligos… and 15 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0471583
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $57.60
About this award
Sigma-Aldrich Inc was awarded a contract by the University of Virginia on August 21, 2026, with a cumulative value of fifty-seven dollars. The contract, identified as A207_PO-0471583, covers the supply of custom DNA oligonucleotides in tube format. The delivery location for all line items is An Nguyen at the University of Virginia in Virginia.
The contract encompasses sixteen distinct DNA oligo products, each with a unit price of $3.60. All products are 20 base-count oligonucleotides processed with desalt purification and delivered in single-tube packages via ambient shipping. The oligonucleotides correspond to various gene sequences including PROSER2AS1F, MEF2CAS1F, LINC01108R, KCNJ2AS1R, ST3GAL6AS1F, and SOCS2AS1R, among others. Each line item is identified by a unique configuration identification number and product number VC00021, with specific DNA sequences tailored to the University of Virginia's research requirements.
Line items
| Item | Total |
|---|---|
| O790 PROSER2AS1F, ConfigurationID: 5671147 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: AGGACCGCTTGAACTCAGAA scale: 0.0250 UMO name: O790 PROSER2AS1F purification: DESALT tubes: 1 packageType | $3.60 |
| O799 LINC01108R, ConfigurationID: 5671156 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: CATTCACACGGCATCTCCTG scale: 0.0250 UMO name: O799 LINC01108R purification: DESALT tubes: 1 packageType: T | $3.60 |
| O800 LINC02082F, ConfigurationID: 5671157 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: CTAACATTGCGCCCCTACAC scale: 0.0250 UMO name: O800 LINC02082F purification: DESALT tubes: 1 packageType: T | $3.60 |
| O801 LINC02082R, ConfigurationID: 5671158 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: TCTCCAAACATGCCAGGTGA scale: 0.0250 UMO name: O801 LINC02082R purification: DESALT tubes: 1 packageType: T | $3.60 |
| O802 SOCS2AS1F, ConfigurationID: 5671159 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: CTTCGTTGAGTGCATCCCAG scale: 0.0250 UMO name: O802 SOCS2AS1F purification: DESALT tubes: 1 packageType: TUB | $3.60 |
| O803 SOCS2AS1R, ConfigurationID: 5671160 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: GTTCGGACTCTCTCTTCCCC scale: 0.0250 UMO name: O803 SOCS2AS1R purification: DESALT tubes: 1 packageType: TUB | $3.60 |
| O804 ST3GAL6AS1F, ConfigurationID: 5671161 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: CCTGGATGATCTGGATGGGC scale: 0.0250 UMO name: O804 ST3GAL6AS1F purification: DESALT tubes: 1 packageType | $3.60 |
| O805 ST3GAL6AS1R, ConfigurationID: 5671162 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: ATTCGAGGAGGAAGGTGCAA scale: 0.0250 UMO name: O805 ST3GAL6AS1R purification: DESALT tubes: 1 packageType | $3.60 |
| O791 PROSER2AS1R, ConfigurationID: 5671148 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: GTGACGAAACTGAGGCACAA scale: 0.0250 UMO name: O791 PROSER2AS1R purification: DESALT tubes: 1 packageType | $3.60 |
| O792 MEF2CAS1F, ConfigurationID: 5671149 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: GCTCCTAGGTATGGGTGGGA scale: 0.0250 UMO name: O792 MEF2CAS1F purification: DESALT tubes: 1 packageType: TUB | $3.60 |
| O793 MEF2CAS1R, ConfigurationID: 5671150 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: TTTGTTGTGTGGTGCGACAG scale: 0.0250 UMO name: O793 MEF2CAS1R purification: DESALT tubes: 1 packageType: TUB | $3.60 |
| O794 LINC00355F, ConfigurationID: 5671151 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: GGGACACCTGCTTACCTCTT scale: 0.0250 UMO name: O794 LINC00355F purification: DESALT tubes: 1 packageType: T | $3.60 |
| O795 LINC00355R, ConfigurationID: 5671152 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: AGCCCAGTCCTAAGTCAACC scale: 0.0250 UMO name: O795 LINC00355R purification: DESALT tubes: 1 packageType: T | $3.60 |
| O796 KCNJ2AS1F, ConfigurationID: 5671153 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: CGTAACAGGGCTTGGTGAAC scale: 0.0250 UMO name: O796 KCNJ2AS1F purification: DESALT tubes: 1 packageType: TUB | $3.60 |
| O797 KCNJ2AS1R, ConfigurationID: 5671154 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: CCTAGGAGGTGCTGGTGAAA scale: 0.0250 UMO name: O797 KCNJ2AS1R purification: DESALT tubes: 1 packageType: TUB | $3.60 |
| O798 LINC01108F, ConfigurationID: 5671155 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: TGGAGGCGAATCTTCAGGTT scale: 0.0250 UMO name: O798 LINC01108F purification: DESALT tubes: 1 packageType: T | $3.60 |
Show all 16
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0471583?
Contract A207_PO-0471583 was awarded to Sigma-Aldrich Inc by University of Virginia on August 21, 2026.
How much is contract A207_PO-0471583 worth?
Its cumulative value is $57.60.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award