AIR ICD inf fw, ConfigurationID: 5669687 Product Number: VC00021 Product Description: DNA Oligos… and 3 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0471477
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $24.66
About this award
Sigma-Aldrich Inc has been awarded a contract by the University of Virginia for the supply of DNA oligonucleotides in Virginia. The contract, identified as A207_PO-0471477, was awarded on August 20, 2026, with a total contract value of $24.00. All deliveries are directed to Tanner Jack Wherley. The contract encompasses four distinct line items, each representing a synthesized DNA oligo product in tube format with desalt purification and ambient shipping specifications.
The four DNA oligonucleotide products include: AIR ICD inf fw (33 base pairs, $5.94), AIR ICD inf rv (35 base pairs, $6.30), Mymg-Halo Inf F (35 base pairs, $6.30), and Mymg-Halo Inf R (34 base pairs, $6.12). Each line item is ordered in a quantity of one tube at the 0.0250 scale. No specific performance period or contract duration is identified in the award documentation provided.
Line items
| Item | Total |
|---|---|
| AIR ICD inf fw, ConfigurationID: 5669687 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 33 shipping: Ambient sequence: GTGTATACGGGAATTTCAGCCGCCCACCCAGAA scale: 0.0250 UMO name: AIR ICD inf fw purification: DESALT tubes: 1 pac | $5.94 |
| AIR ICD inf rv, ConfigurationID: 5669688 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 35 shipping: Ambient sequence: CCCTCGTAAAGAATTATGCTCAGGCTGCTCTTGGC scale: 0.0250 UMO name: AIR ICD inf rv purification: DESALT tubes: 1 p | $6.30 |
| Mymg-Halo Inf F, ConfigurationID: 5669689 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 35 shipping: Ambient sequence: GTGTATACGGGAATTTCAGCCGGAAATCTCGAGCG scale: 0.0250 UMO name: Mymg-Halo Inf F purification: DESALT tubes: 1 | $6.30 |
| Mymg-Halo Inf R, ConfigurationID: 5669690 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 34 shipping: Ambient sequence: CCCTCGTAAAGAATTATGCCCACGCCACTGCTCC scale: 0.0250 UMO name: Mymg-Halo Inf R purification: DESALT tubes: 1 | $6.12 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0471477?
Contract A207_PO-0471477 was awarded to Sigma-Aldrich Inc by University of Virginia on August 20, 2026.
How much is contract A207_PO-0471477 worth?
Its cumulative value is $24.66.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award