Contract A207_PO-0471356
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0471356
- Awardee
- Eurofins Genomics LLC
- Contracting organization
- University of Virginia
- Cumulative value
- $69.40
About this award
Eurofins Genomics LLC was awarded a purchase order (PO-0471356) by the University of Virginia on August 20, 2026, for the delivery of synthetic oligonucleotide sequences. The contract, valued at sixty-nine dollars, encompasses four line items consisting of salt-free DNA oligonucleotides of varying sequences and lengths, each delivered to Edward Perez-Reyes. The individual unit prices range from $10.34 to $23.26 per oligonucleotide sequence.
The awarded products are specialized molecular biology reagents used in genomic research and development applications. All deliverables are designated for the University of Virginia, located in Virginia. The contract represents a transactional procurement of research-grade molecular components, consistent with standard academic and research institution purchasing practices for laboratory consumables and reagents.
Line items
| Item | Total |
|---|---|
| TAGF-AGCTTTCTTTCCCCAGATCCGAGAAGCTTGCCACCATGGCCCGAACC ( 25S,SaltFree) | $10.34 |
| NheXhoU-[PHO]CTAGCCACTTCCTACCCTCGTAAACTGCAGCGC ( 25S,SaltFree) | $23.26 |
| TAGR-TGTAATCCAGAGGTTGATTATCGTGGATCCTTAATTTAGCTTGTGCCCCAGTTTGCT ( 25S,SaltFree) | $12.54 |
| NheXhoL-[PHO]TCGAGCGCTGCAGTTTACGAGGGTAGGAAGTGG ( 25S,SaltFree) | $23.26 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0471356?
Contract A207_PO-0471356 was awarded to Eurofins Genomics LLC by University of Virginia on August 20, 2026.
How much is contract A207_PO-0471356 worth?
Its cumulative value is $69.40.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award