O770 KHDRBS1F, ConfigurationID: 5665104 Product Number: VC00021 Product Description: DNA Oligos… and 15 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0470488
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $64.26
About this award
Sigma-Aldrich Inc. received a contract award from the University of Virginia on August 19, 2026, valued at sixty-four dollars. The contract, identified as A207_PO-0470488, involves the supply of deoxyribonucleic acid (DNA) oligonucleotides in tube format. All line items are designated for delivery to An Nguyen and will be shipped via ambient conditions.
The contract comprises sixteen distinct DNA oligo products, each in a 0.0250 scale tube with desalting purification. The individual items range in price from $3.96 to $4.14 per unit, with unit prices determined by base count—twenty-two base count oligonucleotides priced at $3.96 and twenty-three base count oligonucleotides priced at $4.14. The oligonucleotides represent various genetic markers and sequences, including KHDRBS1, CCAR1, LINC00477, LINC01122, and HNRNPA1 variants. No specific contract performance period or expiration date is indicated in the award documentation.
Line items
| Item | Total |
|---|---|
| O770 KHDRBS1F, ConfigurationID: 5665104 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: GGCATCCAGAGGATACCTTTGC scale: 0.0250 UMO name: O770 KHDRBS1F purification: DESALT tubes: 1 packageType: TUB | $3.96 |
| O779 CCAR1R, ConfigurationID: 5665113 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 23 shipping: Ambient sequence: GGTAGCGAATCTCTGCAAAACGG scale: 0.0250 UMO name: O779 CCAR1R purification: DESALT tubes: 1 packageType: TUBE m | $4.14 |
| O780 Ccar1F, ConfigurationID: 5665114 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: TCTCCTTCGCTGGATGGACCAA scale: 0.0250 UMO name: O780 Ccar1F purification: DESALT tubes: 1 packageType: TUBE me | $3.96 |
| O781 Ccar1R, ConfigurationID: 5665115 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 23 shipping: Ambient sequence: GGTAGCGAATCTCTGCAAAACGG scale: 0.0250 UMO name: O781 Ccar1R purification: DESALT tubes: 1 packageType: TUBE m | $4.14 |
| O782 LINC00477F, ConfigurationID: 5665116 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: GCCTCCACTTTGACTGGCTTCT scale: 0.0250 UMO name: O782 LINC00477F purification: DESALT tubes: 1 packageType | $3.96 |
| O783 LINC00477R, ConfigurationID: 5665117 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: AACACGGTGGGAAGGCGAAGAA scale: 0.0250 UMO name: O783 LINC00477R purification: DESALT tubes: 1 packageType | $3.96 |
| O784 LINC01122F, ConfigurationID: 5665118 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 23 shipping: Ambient sequence: CTATGTCAACTCTTCTGGCAGAG scale: 0.0250 UMO name: O784 LINC01122F purification: DESALT tubes: 1 packageType | $4.14 |
| O772 Khdrbs1F, ConfigurationID: 5665106 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 23 shipping: Ambient sequence: GGCTATTACAGCCAGAGTCAAGG scale: 0.0250 UMO name: O772 Khdrbs1F purification: DESALT tubes: 1 packageType: TU | $4.14 |
| O785 LINC01122R, ConfigurationID: 5665119 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: CCTTGCTCTGTGCCTCAGTTTC scale: 0.0250 UMO name: O785 LINC01122R purification: DESALT tubes: 1 packageType | $3.96 |
| O773 Khdrbs1R, ConfigurationID: 5665107 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: TAGCTGGAGGAGCCTTCAGTGA scale: 0.0250 UMO name: O773 Khdrbs1R purification: DESALT tubes: 1 packageType: TUB | $3.96 |
| O778 CCAR1F, ConfigurationID: 5665112 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: ACTGGTCTCCTTCGTTGGATGG scale: 0.0250 UMO name: O778 CCAR1F purification: DESALT tubes: 1 packageType: TUBE me | $3.96 |
| O775 HNRNPA1R, ConfigurationID: 5665109 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: CGACCACTGAAGTTTCCTCCAC scale: 0.0250 UMO name: O775 HNRNPA1R purification: DESALT tubes: 1 packageType: TUB | $3.96 |
| O776 Hnrnpa1F, ConfigurationID: 5665110 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: CGAAACAACCGACGAGAGTCTG scale: 0.0250 UMO name: O776 Hnrnpa1F purification: DESALT tubes: 1 packageType: TUB | $3.96 |
| O777 Hnrnpa1R, ConfigurationID: 5665111 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: CATGGCAGCATCCACTTCTTCC scale: 0.0250 UMO name: O777 Hnrnpa1R purification: DESALT tubes: 1 packageType: TUB | $3.96 |
| O771 KHDRBS1R, ConfigurationID: 5665105 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 23 shipping: Ambient sequence: CCTTGACTCTGGCTGTAATAGCC scale: 0.0250 UMO name: O771 KHDRBS1R purification: DESALT tubes: 1 packageType: TU | $4.14 |
| O774 HNRNPA1F, ConfigurationID: 5665108 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: GCCCTGTCAAAGCAAGAGATGG scale: 0.0250 UMO name: O774 HNRNPA1F purification: DESALT tubes: 1 packageType: TUB | $3.96 |
Show all 16
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0470488?
Contract A207_PO-0470488 was awarded to Sigma-Aldrich Inc by University of Virginia on August 19, 2026.
How much is contract A207_PO-0470488 worth?
Its cumulative value is $64.26.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award