Contract A207_PO-0469669
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0469669
- Awardee
- Eurofins Genomics LLC
- Contracting organization
- University of Virginia
- Cumulative value
- $86.20
About this award
The University of Virginia awarded a contract to Eurofins Genomics LLC on August 15, 2026, for the procurement of synthetic oligonucleotide sequences. The contract, designated A207_PO-0469669, is valued at eighty-six dollars and encompasses eight distinct line items consisting of salt-free, 10-scale oligonucleotide products with varying nucleotide sequences. All deliverables are designated for delivery to Jon Chen at the University of Virginia in Virginia.
The contract comprises eight separate oligonucleotide sequences designated as C19, C21, C22, C23, C25, C26, E19, and E20, with individual unit prices ranging from $7.22 to $16.40. Each line item is specified at a quantity of one unit. As a genomics and molecular biology service provider, Eurofins Genomics LLC will fulfill this procurement of custom synthetic DNA sequences, which are commonly utilized in research applications at academic institutions.
Line items
| Item | Total |
|---|---|
| C19-AGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAAGAAGCTGCTGCTAAGGAAG ( 10S,SaltFree) | $16.22 |
| C21-AATTCGCTTATTTAGAAGTGGC ( 10S,SaltFree) | $7.76 |
| C26-GCGCGCCACTTCTAAATAAG ( 10S,SaltFree) | $7.40 |
| C25-TTTGTATAGTTCATCCATGCCATG ( 10S,SaltFree) | $8.12 |
| C22-GAAGCTGCTGCTAAGGAAG ( 10S,SaltFree) | $7.22 |
| E19-TCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAATCCAGTATAGCGACCAGCATTC ( 10S,SaltFree) | $16.40 |
| C23-GAGGTCTTCTTCGGAAATC ( 10S,SaltFree) | $7.22 |
| E20-GCTCTAATTTGTGAGTTTAGTATACATGCATTTACTTATAATACAGTTTTCCGGTAGAGGTGTGGTC ( 10S,SaltFree) | $15.86 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0469669?
Contract A207_PO-0469669 was awarded to Eurofins Genomics LLC by University of Virginia on August 15, 2026.
How much is contract A207_PO-0469669 worth?
Its cumulative value is $86.20.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award