Contract A207_PO-0466680
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0466680
- Awardee
- Eurofins Genomics LLC
- Contracting organization
- University of Virginia
- Cumulative value
- $22.44
About this award
The University of Virginia awarded contract A207_PO-0466680 to Eurofins Genomics LLC on August 7, 2026, for the procurement of synthesized oligonucleotide sequences. The contract, valued at twenty-two dollars, encompasses two line items representing custom-synthesized DNA sequences totaling 25 nucleotides each in salt-free formulation. Both sequences are designated for delivery to Edward Perez-Reyes and carry an individual unit price of $11.22 per sequence.
The deliverables consist of specialized molecular biology products: BB2F2-TGTATAAGTTCTGCTACGAGAACGAGGTGTACAGCTATGGCCCCGGCAGCG and BB1R2-CGCTGCCGGGGCCATAGCTGTACACCTCGTTCTCGTAGCAGAACTTATACA, each ordered as a single unit. As a prime contractor, Eurofins Genomics LLC, a established provider of genomics and molecular biology services, fulfilled this requirement for the University of Virginia in the Commonwealth of Virginia.
Line items
| Item | Total |
|---|---|
| BB2F2-TGTATAAGTTCTGCTACGAGAACGAGGTGTACAGCTATGGCCCCGGCAGCG ( 25S,SaltFree) | $11.22 |
| BB1R2-CGCTGCCGGGGCCATAGCTGTACACCTCGTTCTCGTAGCAGAACTTATACA ( 25S,SaltFree) | $11.22 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0466680?
Contract A207_PO-0466680 was awarded to Eurofins Genomics LLC by University of Virginia on August 7, 2026.
How much is contract A207_PO-0466680 worth?
Its cumulative value is $22.44.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award