oJDW 2693, ConfigurationID: 5633589 Product Number: VC00021 Product Description: DNA Oligos in Tubes… and 1 more item

The University of Virginia awarded contract A207_PO-0466161 to Sigma-Aldrich Inc on August 6, 2026, for the procurement of custom DNA oligonucleotides. The contract, valued at fifteen dollars, covers two distinct line items comprising synthesized DNA oligos in tube format, both designated for delivery to Athira Pillai. The first line item (oJDW 2693) consists of a 45-base-count DNA oligonucleotide with the sequence GCAAATTAATACGACTCACTATAGGGACCTCGGCTGTAGCTTTGG, procured at a unit price of $8.10. The second line item (oJDW 2694) consists of a 43-base-count DNA oligonucleotide with the sequence TACGATTTAGGTGACACTATAGCAAGTCCCTTTCTGCTCTGGG, procured at a unit price of $7.74.

Both DNA oligonucleotides are supplied in single-tube quantities using desalt purification methodology at a 0.0250 scale, with ambient shipping. The contract represents a research procurement supporting the University of Virginia's laboratory operations in Virginia. No specific period of performance or county designation is provided in the contract documentation.