Contract A207_PO-0465077
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0465077
- Awardee
- Eurofins Genomics LLC
- Contracting organization
- University of Virginia
- Cumulative value
- $10.25
About this award
Eurofins Genomics LLC was awarded a contract by the University of Virginia on August 4, 2026, for the delivery of genetic sequencing materials. The contract, designated A207_PO-0465077, is valued at ten dollars and represents a purchase order issued by the Virginia-based contracting organization. The deliverable location is designated to Carolyn Sue Smith.
The contract encompasses two line items for oligonucleotide sequences of GTPBP2 genetic material. The first line item consists of one unit of F GTPBP2 sequence (GGTGAATCCATCCCAGTACCG, 50S, Salt Free) priced at $5.25, and the second line item comprises one unit of R GTPBP2 sequence (CCAAGCAGAGTTGACTTCCC, 50S, Salt Free) priced at $5.00. No additional information regarding the period of performance beyond the award date or specific county designation is provided in the contract documentation.
Line items
| Item | Total |
|---|---|
| F GTPBP2 seq-GGTGAATCCATCCCAGTACCG ( 50S,SaltFree) | $5.25 |
| R GTPBP2 seq-CCAAGCAGAGTTGACTTCCC ( 50S,SaltFree) | $5.00 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0465077?
Contract A207_PO-0465077 was awarded to Eurofins Genomics LLC by University of Virginia on August 4, 2026.
How much is contract A207_PO-0465077 worth?
Its cumulative value is $10.25.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award