CASP7 F, ConfigurationID: 5554719 Product Number: VC00021 Product Description: DNA Oligos in Tubes… and 11 more items

State & local contract award Virginia Awarded

Contract number
A207_PO-0461604
Awardee
Sigma-Aldrich Inc
Contracting organization
University of Virginia
Cumulative value
$43.38

About this award

Written by GovTribe AI ·

The University of Virginia awarded contract A207_PO-0461604 to Sigma-Aldrich Inc on July 24, 2026, with a cumulative contract value of $43.00. The contract encompasses the procurement of twelve DNA oligonucleotide (oligo) products in tube format, delivered to MariCarmen Lafita Navarro. These synthetic DNA sequences range from 19 to 22 base pairs in length and include forward and reverse primer pairs for various genes including CASP7, TABPB, SH3TC1, FAM32A, FAM133B, and GGT5. All line items specify DESALT purification, ambient shipping conditions, 0.0250 scale quantities, and single tube packaging.

Individual line item unit prices range from $3.42 to $3.96 per oligo product, with most standard 20 base-pair sequences priced at $3.60 each. The slight pricing variations correlate with differences in base pair counts, with shorter sequences (19 bases) at $3.42 and longer sequences (21-22 bases) priced at $3.78 and $3.96 respectively. All products maintain the same product number designation (VC00021) and are configured for ambient delivery to the University of Virginia's research facility in Virginia.

Line items

Item Total
CASP7 F, ConfigurationID: 5554719 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: ATGCGATCCATCAAGACCAC scale: 0.0250 UMO name: CASP7 F purification: DESALT tubes: 1 packageType: TUBE meltingTempa 1 Each × $3.60 $3.60
TABPB F, ConfigurationID: 5554729 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: GCTTGGGATGATGATGAGCC scale: 0.0250 UMO name: TABPB F purification: DESALT tubes: 1 packageType: TUBE meltingTempa 1 Each × $3.60 $3.60
TABPB R, ConfigurationID: 5554730 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: ACACAAGGCAGAGCAATTCC scale: 0.0250 UMO name: TABPB R purification: DESALT tubes: 1 packageType: TUBE meltingTempa 1 Each × $3.60 $3.60
CASP7 R, ConfigurationID: 5554720 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: AATCACGTCAAAACCCAGGC scale: 0.0250 UMO name: CASP7 R purification: DESALT tubes: 1 packageType: TUBE meltingTempa 1 Each × $3.60 $3.60
SH3TC1 R, ConfigurationID: 5554728 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: CGAGAGCATGGTAGGTGGAA scale: 0.0250 UMO name: SH3TC1 R purification: DESALT tubes: 1 packageType: TUBE meltingTem 1 Each × $3.60 $3.60
FAM32A F, ConfigurationID: 5554721 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: ACTCCTGGAAGCAATGGGAA scale: 0.0250 UMO name: FAM32A F purification: DESALT tubes: 1 packageType: TUBE meltingTem 1 Each × $3.60 $3.60
FAM32A R, ConfigurationID: 5554722 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: TGTGGGTTTTGGATGCCTTC scale: 0.0250 UMO name: FAM32A R purification: DESALT tubes: 1 packageType: TUBE meltingTem 1 Each × $3.60 $3.60
FAM133B F, ConfigurationID: 5554723 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 21 shipping: Ambient sequence: TCAAGCTCTGATTCTTCCAGC scale: 0.0250 UMO name: FAM133B F purification: DESALT tubes: 1 packageType: TUBE melting 1 Each × $3.78 $3.78
FAM133B R, ConfigurationID: 5554724 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: AGTTTCTGACATGGAGCTTTCA scale: 0.0250 UMO name: FAM133B R purification: DESALT tubes: 1 packageType: TUBE meltin 1 Each × $3.96 $3.96
GGT5 F, ConfigurationID: 5554725 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 19 shipping: Ambient sequence: TGTCCTCAGCCGTTTCCTG scale: 0.0250 UMO name: GGT5 F purification: DESALT tubes: 1 packageType: TUBE meltingTemparat 1 Each × $3.42 $3.42
GGT5 R, ConfigurationID: 5554726 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 20 shipping: Ambient sequence: CTCCCCGTGTAGAAGACCTC scale: 0.0250 UMO name: GGT5 R purification: DESALT tubes: 1 packageType: TUBE meltingTempara 1 Each × $3.60 $3.60
SH3TC1 F, ConfigurationID: 5554727 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 19 shipping: Ambient sequence: GCGGAGGAAGAGCAGACTG scale: 0.0250 UMO name: SH3TC1 F purification: DESALT tubes: 1 packageType: TUBE meltingTemp 1 Each × $3.42 $3.42
Show all 12

Award details come from logi.cgieva.com. Updated .

Quick answers

Who was awarded contract A207_PO-0461604?

Contract A207_PO-0461604 was awarded to Sigma-Aldrich Inc by University of Virginia on July 24, 2026.

How much is contract A207_PO-0461604 worth?

Its cumulative value is $43.38.

On GovTribe

See this award's full record

  • Every line item and file
  • The contract it was ordered under and its other orders
  • Similar state and local awards and opportunities
  • Ask GovTribe AI about this award
Try for free Login