Name:ATGL 1-38 FLAG XBP1…

The University of Virginia has awarded a contract to Integrated DNA Technologies Inc. for the procurement of synthetic DNA oligonucleotides, specifically 45 units of ATGL 1-38 FLAG XBP1 sequence products. The award was issued on August 1, 2026, with a total contract value of $45.00. The deliverables consist of DNA sequences with the specification CCGGTACATGTTTCCCCGCGAGAAGACGTGGAACATCTCGTTCGCGGGCTGCGGCTTCCTCGGCGTCTACTACGTCGGCGTGGCCTCCTGCCCTCCGCGAGCACGCGCCCCTTCCTGGTGGCCDACTACAAAGATGATGACGATAAGGGATCCTGTGCCCCTACCAGCCTCCATTTCTGTGTCAGTGGGCAGACACCAGTGCGCCTGGAAGCCTCTGAT, with delivery to the buyer at the University of Virginia in Virginia.

Integrated DNA Technologies Inc. serves as the prime contractor on this purchase order (PO-0459075), which represents a routine procurement of research-grade molecular biology reagents. The per-unit cost of $1.00 reflects a standard unit pricing structure for this commodity. While the specific period of performance is not explicitly detailed in the contract documentation, the award date of August 1, 2026, establishes the contract initiation timeline. This procurement supports the University of Virginia's research and educational missions requiring synthetic DNA constructs for molecular biology applications.