Name:RLP4-Xbp1_GBlock… and 2 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0458965-V3
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $86.96
About this award
Integrated DNA Technologies Inc has been awarded a contract by the University of Virginia, effective August 1, 2026, with a cumulative value of $86.00. The contracting organization is located in Virginia. This contract involves the delivery of synthetic DNA products and oligonucleotides to support research activities at the University of Virginia.
The contract encompasses three distinct line items totaling 86 units: 64 units of an RLP4-Xbp1 GBlock sequence product and 11 units each of two complementary DNA oligonucleotides designated K71A F and K71A Rev, both specified at 25 nanomole concentration with standard desalting purification and 55 base pairs. All products are priced at $1.00 per unit and are to be delivered to the buyer at the University of Virginia. The contract specifications indicate these are research-grade molecular biology reagents used for genetic research and molecular cloning applications.
Line items
| Item | Total |
|---|---|
| Name:RLP4-Xbp1_GBlock Sequence:ACGTTGTAAAACGACGGCCAGTGAATTGACGCGTATTGGGATATCCCAATTGCGCGCCTAATACGACTCACTATAGGCCGCCACCATGGATTACAAGGACCATGATGGAGATTACAAAGACCATGACATTGATTATAAGGACGATGATGACAAGAGCAGCGGCTTGGAAGTGCTGTTCCAGGGTCCGAGCGGAATGGCGTGTGCTCGCCCACTGATATCG | $64.00 |
| Name:K71A F Sequence:CCA CCA ACA CAG TTT TTG ATG CCG CGC GTC TGA TTG GAC GCA GAT TTG ATG ATG C Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:55 | $11.00 |
| Name:K71A Rev Sequence:GCA TCA TCA AAT CTG CGT CCA ATC AGA CGC GCG GCA TCA AAA ACT GTG TTG GTG G Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:55 | $11.00 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0458965-V3?
Contract A207_PO-0458965-V3 was awarded to Integrated DNA Technologies Inc by University of Virginia on August 1, 2026.
How much is contract A207_PO-0458965-V3 worth?
Its cumulative value is $86.96.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award