oJDW 34, ConfigurationID: 5498472 Product Number: VC00021 Product Description: DNA Oligos in Tubes… and 2 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0458616
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $12.06
About this award
The University of Virginia awarded a contract to Sigma-Aldrich Inc. for the provision of DNA oligonucleotides, with an award date of July 15, 2026. The contract, identified as A207_PO-0458616, is valued at twelve dollars and encompasses three line items delivering customized DNA oligos in tube format to Athira Pillai. The three products—designated oJDW 34, oJDW 701, and oJDW 702—are manufactured to specified sequences and base counts, with unit prices ranging from $3.78 to $4.32 per item.
The ordered DNA oligonucleotides are all subject to desalting purification and ambient shipping conditions. oJDW 34 contains 21 bases and is priced at $3.78; oJDW 701 contains 24 bases and is priced at $4.32; and oJDW 702 contains 22 bases and is priced at $3.96. All three oligonucleotides are delivered in single-tube packages at a 0.0250 scale. The contract is performable in Virginia through the University of Virginia's procurement process, with delivery designated to the specified recipient at the contracting organization.
Line items
| Item | Total |
|---|---|
| oJDW 34, ConfigurationID: 5498472 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 21 shipping: Ambient sequence: CTCTGCTGCCTCCTGGCTTCT scale: 0.0250 UMO name: oJDW 34 purification: DESALT tubes: 1 packageType: TUBE meltingTemp | $3.78 |
| oJDW 701, ConfigurationID: 5498473 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Ambient sequence: GCGTCTCACTCTCCTCGACTCTTC scale: 0.0250 UMO name: oJDW 701 purification: DESALT tubes: 1 packageType: TUBE meltin | $4.32 |
| oJDW 702, ConfigurationID: 5498474 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 22 shipping: Ambient sequence: GTAGTTTCCGGCGCACTGGCAG scale: 0.0250 UMO name: oJDW 702 purification: DESALT tubes: 1 packageType: TUBE meltingT | $3.96 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0458616?
Contract A207_PO-0458616 was awarded to Sigma-Aldrich Inc by University of Virginia on July 15, 2026.
How much is contract A207_PO-0458616 worth?
Its cumulative value is $12.06.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award