Name:rpsk_campyflanks… and 1 more item
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0457132
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $90.00
About this award
Integrated DNA Technologies Inc. has been awarded a contract by the University of Virginia with an award date of July 11, 2026, for a cumulative contract value of $90. The contract is identified as A207_PO-0457132 and is classified under Virginia state contracts. The prime contractor will deliver specialized DNA sequences to Pablo Penataro Yori Sr. as the designated recipient.
The contract encompasses two line items, each valued at $45 per unit with a quantity of one unit each. The first line item involves the provision of an rpsk_campyflanks DNA sequence, while the second line item consists of an rpsk_artflanks DNA sequence. Both deliverables are categorized as individual units and represent molecular biology research materials. The contract documents do not specify an explicit period of performance, annual value breakdown, or county-level geographic designation beyond the Virginia state designation.
Line items
| Item | Total |
|---|---|
| Name:rpsk_campyflanks Sequence:AGAGAAACTGCTGTTAAGAGTGTAGGTGCTATGGAAGGAATCAAAGTAACTTTCTTAAAAGATATCACTCCATTAGCTCACAATGGTTGCAGACCGCCTAAGCGTCGTCGTGTCTAAGATATAAGAAAAATTTAGGAGAATATTATGGCAAGATATAGAGGACCAGTAGAAAAATTAGAAAGACGCTTTGGTGTTAGCTTAGCATTAAAAGGAGAAAGAA | $45.00 |
| Name:rpsk_artflanks Sequence:CTGACTAGCATCGGATTACGCTAAGGTGCTATGGAAGGAATCAAAGTAACTTTCTTAAAAGATATCACTCCATTAGCTCACAATGGTTGCAGACCGCCTAAGCGTCGTCGTGTCTAAGATATAAGAAAAATTTAGGAGAATATTATGGCAAGATATAGAGGACCAGTAGAAAAATTAGAAAGACGCTTTGGTGTTAGCTTAGCATTAGCTAGTGCATCGATT | $45.00 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0457132?
Contract A207_PO-0457132 was awarded to Integrated DNA Technologies Inc by University of Virginia on July 11, 2026.
How much is contract A207_PO-0457132 worth?
Its cumulative value is $90.00.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award