oJDW 2685, ConfigurationID: 5454620 Product Number: VC00021 Product Description: DNA Oligos in Tubes… and 1 more item

The University of Virginia awarded contract A207_PO-0455242 to Sigma-Aldrich Inc. on July 7, 2026, with a cumulative contract value of $7.00. The prime contractor will deliver two distinct DNA oligonucleotide products, both classified as DNA Oligos in Tubes (Product Number VC00021). The first line item, designated oJDW 2685, consists of one tube containing a 20 base-count DNA oligonucleotide with the sequence GGCTTCTTTCTTGGGTCCTG at a 0.0250 scale with DESALT purification, priced at $3.60 per unit. The second line item, oJDW 2686, comprises one tube of a 20 base-count DNA oligonucleotide with the sequence GGCTCATTTGGGTTGCTTCT at an identical 0.0250 scale with DESALT purification, also priced at $3.60 per unit.

Both line items are scheduled for ambient shipping and will be delivered to Athira Pillai at the University of Virginia in Virginia. The contract represents a procurement of molecular biology research materials typical of academic scientific institutions. No additional contract performance period information, specific county designation, or place of performance details beyond the University of Virginia were provided in the available documentation.