HB_oligo1-F, ConfigurationID: 5445746 Product Number: VC00021 Product Description: DNA Oligos… and 3 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0454640
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $20.16
About this award
The University of Virginia awarded contract A207_PO-0454640 to Sigma-Aldrich Inc. on August 1, 2026, with a cumulative value of twenty dollars. The contract is for the supply of four distinct deoxyribonucleic acid (DNA) oligonucleotides in tube format, delivered to the buyer in Virginia. The four line items consist of HB_oligo1-F (3 units), HB_oligo2-R (4 units), HB_oligo3-F (6 units), and HB_oligo4-R (6 units), each priced at one dollar per unit. All oligonucleotides are supplied at a 0.0250 scale with desalted purification and ambient shipping specifications.
The DNA oligonucleotide products feature varying base counts and sequences tailored for molecular biology applications. HB_oligo1-F contains 19 bases, HB_oligo2-R contains 23 bases, HB_oligo3-F contains 36 bases, and HB_oligo4-R contains 34 bases. All line items are classified under Product Number VC00021 and specify delivery in individual tube packages. No specific period of performance or place of performance beyond the University of Virginia is indicated in the contract documentation.
Line items
| Item | Total |
|---|---|
| HB_oligo1-F, ConfigurationID: 5445746 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 19 shipping: Ambient sequence: GGAACCGGATCCATGGCAG scale: 0.0250 UMO name: HB_oligo1-F purification: DESALT tubes: 1 packageType: TUBE melti | $3.00 |
| HB_oligo2-R, ConfigurationID: 5445747 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 23 shipping: Ambient sequence: GAATTCCGGTGGTTCACGTTGAC scale: 0.0250 UMO name: HB_oligo2-R purification: DESALT tubes: 1 packageType: TUBE m | $4.00 |
| HB_oligo3-F, ConfigurationID: 5445748 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 36 shipping: Ambient sequence: GAACCACCGGAATTCCCCCCAGACCACATTCCTTGG scale: 0.0250 UMO name: HB_oligo3-F purification: DESALT tubes: 1 packag | $6.00 |
| HB_oligo4-R, ConfigurationID: 5445749 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 34 shipping: Ambient sequence: CATGGATCCGGTTCCCCGAGGCCGCTTCTTCTTC scale: 0.0250 UMO name: HB_oligo4-R purification: DESALT tubes: 1 packageT | $6.00 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0454640?
Contract A207_PO-0454640 was awarded to Sigma-Aldrich Inc by University of Virginia on August 1, 2026.
How much is contract A207_PO-0454640 worth?
Its cumulative value is $20.16.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award