Contract A207_PO-0452928
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0452928
- Awardee
- Eurofins Genomics LLC
- Contracting organization
- University of Virginia
- Cumulative value
- $155.70
About this award
Eurofins Genomics LLC has been awarded contract A207_PO-0452928 by the University of Virginia on June 26, 2026, with a cumulative contract value of $155.00. The prime contractor will deliver specialized oligonucleotide synthesis products to Travis S Lillard at the University of Virginia. The contract encompasses two line items: a 50-nucleotide salt-free oligonucleotide sequence (KLW333_F-GGACCCAAGGCCTATGTCA) priced at $4.75, and a 200-nucleotide high-performance liquid chromatography (HPLC) purified oligonucleotide sequence (KLW333_R-[BIO]ATGAGCTTGACGCTACTGACTCG) priced at $150.95.
The contract represents a materials procurement for molecular biology research applications within Virginia. As a purchase order-based award, this transaction provides synthetic DNA oligonucleotides with specified quality parameters and purification standards typical of academic research requirements. No specific contract performance period, annual value, or county designation is documented in the available award materials.
Line items
| Item | Total |
|---|---|
| KLW333_F-GGACCCAAGGCCTATGTCA ( 50S,SaltFree) | $4.75 |
| KLW333_r-[BIO]atgagcttgacgctactgactcg ( 200S,hplc) | $150.95 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0452928?
Contract A207_PO-0452928 was awarded to Eurofins Genomics LLC by University of Virginia on June 26, 2026.
How much is contract A207_PO-0452928 worth?
Its cumulative value is $155.70.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award