Contract A207_PO-0452675

The University of Virginia awarded a contract to Eurofins Genomics LLC on June 25, 2026, for the provision of specialized genomic products. The contract, identified as A207_PO-0452675, is valued at $156.95 and involves the delivery of two distinct oligonucleotide sequences to Travis S Lillard. The first line item consists of a salt-free, 50-scale oligonucleotide designated CR101B_geno_F4-TACTAGTGCGACCATCAGTTTCTG, priced at $6.00 per unit. The second line item comprises a high-performance liquid chromatography (HPLC) purified, 200-scale oligonucleotide designated CR101B_geno_R4-[BIO]GTCCGAACTGTCACTTTTCAGTC, priced at $150.95 per unit.

Eurofins Genomics LLC, as the prime contractor, is responsible for fulfilling this purchase order within the Commonwealth of Virginia. The contract represents a single procurement action with a cumulative value of $156.95. No annual value or extended contract period is specified in the award documentation, indicating this is a one-time purchase order for research-grade genomic materials. The University of Virginia, as the contracting organization, has designated these products for delivery to the specified recipient at its Virginia location.