oJDW 2681, ConfigurationID: 5424652 Product Number: VC00021 Product Description: DNA Oligos in Tubes…
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0452594
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $3.78
About this award
The University of Virginia awarded contract A207_PO-0452594 to Sigma-Aldrich Inc. on June 25, 2026, for the supply of specialized molecular biology materials. The contract, valued at $3.00, represents a single purchase order for custom deoxyribonucleic acid (DNA) oligonucleotides. The award is classified as a state and local contract within Virginia and was delivered to Natalie Lisenby.
The line item encompasses one unit of DNA Oligos in Tubes (catalog designation oJDW 2681) with a 21-base-pair sequence (CCTGGACTACTGCGCCCTAGG) at a unit price of $3.78. The oligonucleotide was synthesized at a 0.0250 micromole scale using desalt purification methodology and was packaged in a single tube for ambient shipping. This contract represents a routine procurement of research-grade molecular biology reagents required for laboratory operations at the University of Virginia.
Line items
| Item | Total |
|---|---|
| oJDW 2681, ConfigurationID: 5424652 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 21 shipping: Ambient sequence: CCTGGACTACTGCGCCCTAGG scale: 0.0250 UMO name: oJDW 2681 purification: DESALT tubes: 1 packageType: TUBE melting | $3.78 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0452594?
Contract A207_PO-0452594 was awarded to Sigma-Aldrich Inc by University of Virginia on June 25, 2026.
How much is contract A207_PO-0452594 worth?
Its cumulative value is $3.78.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award