Name:top_COP1_G1 AAACAGTGGACACAGTGATCTGCACAG 25nm STD Sequence:AAA CAG TGG ACA CAG TGA TCT GCA CAG… and 7 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0452546-V3
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $43.52
About this award
The University of Virginia awarded contract A207_PO-0452546-V3 to Integrated DNA Technologies Inc. on August 1, 2026, with a cumulative value of $43. The contract covers the supply of eight distinct synthetic deoxyribonucleic acid (DNA) oligonucleotide sequences, each ordered in quantities of five units at $1 per unit. All oligonucleotides are manufactured at 25 nanomole scale with standard desalting purification, ranging from 27 bases in length.
The line items include six top-strand and two bottom-strand complementary DNA sequences designated as variants of the COP1 gene construct (COP1_G1, COP1_G2, COP1_G5, and COP1_G6). These synthetic oligonucleotides are used for molecular biology research applications, including polymerase chain reaction (PCR) primer design, gene assembly, or cloning procedures. Delivery is to the University of Virginia as the end-use organization in Virginia. No specific performance period end date is provided in the contract documentation.
Line items
| Item | Total |
|---|---|
| Name:top_COP1_G1 AAACAGTGGACACAGTGATCTGCACAG 25nm STD Sequence:AAA CAG TGG ACA CAG TGA TCT GCA CAG Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:top_COP1_G2 AAACTGGACACAGTGATCTGCACAGCC 25nm STD Sequence:AAA CTG GAC ACA GTG ATC TGC ACA GCC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:top_COP1_G6 AAACAGCCACTCATTTCTTCCACTCTC 25nm STD Sequence:AAA CAG CCA CTC ATT TCT TCC ACT CTC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:bottom_COP1_G2 AAAAGGCTGTGCAGATCACTGTGTCCA 25nm STD Sequence:AAA AGG CTG TGC AGA TCA CTG TGT CCA Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:bottom_COP1_G1 AAAACTGTGCAGATCACTGTGTCCACT 25nm STD Sequence:AAA ACT GTG CAG ATC ACT GTG TCC ACT Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:bottom_COP1_G5 AAAAGAGTGGAAGAAATGAGTGGCTTA 25nm STD Sequence:AAA AGA GTG GAA GAA ATG AGT GGC TTA Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:bottom_COP1_G6 AAAAGAGAGTGGAAGAAATGAGTGGCT 25nm STD Sequence:AAA AGA GAG TGG AAG AAA TGA GTG GCT Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:top_COP1_G5 AAACTAAGCCACTCATTTCTTCCACTC 25nm STD Sequence:AAA CTA AGC CAC TCA TTT CTT CCA CTC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0452546-V3?
Contract A207_PO-0452546-V3 was awarded to Integrated DNA Technologies Inc by University of Virginia on August 1, 2026.
How much is contract A207_PO-0452546-V3 worth?
Its cumulative value is $43.52.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award