Name:top_COP1_G1 AAACAGTGGACACAGTGATCTGCACAG 25nm STD Sequence:AAA CAG TGG ACA CAG TGA TCT GCA CAG… and 7 more items
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0452546
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $43.52
About this award
The University of Virginia has awarded a contract to Integrated DNA Technologies Inc. under purchase order A207_PO-0452546, effective August 1, 2026. The contract is valued at forty-three dollars and covers the supply of synthesized deoxyribonucleic acid (DNA) oligonucleotides for research purposes. The awarded contract involves eight distinct DNA sequences, each designated as 25 nanomole standard products with standard desalting purification, consisting of 27 bases per oligonucleotide. Each line item specifies a quantity of five units at one dollar per unit.
The contract deliverables encompass DNA oligos identified as top_COP1_G1, top_COP1_G2, top_COP1_G5, top_COP1_G6, bottom_COP1_G1, bottom_COP1_G2, bottom_COP1_G5, and bottom_COP1_G6, with delivery directed to the buyer at the University of Virginia. The specific sequences and nomenclature indicate these oligonucleotides are likely supporting a research initiative at the institution in Virginia. As a higher education research institution serving as the contracting organization, the University of Virginia is identified as the place of performance for this procurement of molecular biology research materials.
Line items
| Item | Total |
|---|---|
| Name:top_COP1_G1 AAACAGTGGACACAGTGATCTGCACAG 25nm STD Sequence:AAA CAG TGG ACA CAG TGA TCT GCA CAG Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:top_COP1_G2 AAACTGGACACAGTGATCTGCACAGCC 25nm STD Sequence:AAA CTG GAC ACA GTG ATC TGC ACA GCC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:top_COP1_G5 AAACTAAGCCACTCATTTCTTCCACTC 25nm STD Sequence:AAA CTA AGC CAC TCA TTT CTT CCA CTC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:bottom_COP1_G2 AAAAGGCTGTGCAGATCACTGTGTCCA 25nm STD Sequence:AAA AGG CTG TGC AGA TCA CTG TGT CCA Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:top_COP1_G6 AAACAGCCACTCATTTCTTCCACTCTC 25nm STD Sequence:AAA CAG CCA CTC ATT TCT TCC ACT CTC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:bottom_COP1_G1 AAAACTGTGCAGATCACTGTGTCCACT 25nm STD Sequence:AAA ACT GTG CAG ATC ACT GTG TCC ACT Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:bottom_COP1_G5 AAAAGAGTGGAAGAAATGAGTGGCTTA 25nm STD Sequence:AAA AGA GTG GAA GAA ATG AGT GGC TTA Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
| Name:bottom_COP1_G6 AAAAGAGAGTGGAAGAAATGAGTGGCT 25nm STD Sequence:AAA AGA GAG TGG AAG AAA TGA GTG GCT Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:27 | $5.00 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0452546?
Contract A207_PO-0452546 was awarded to Integrated DNA Technologies Inc by University of Virginia on August 1, 2026.
How much is contract A207_PO-0452546 worth?
Its cumulative value is $43.52.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award