Contract A207_PO-0450065
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0450065
- Awardee
- Eurofins Genomics LLC
- Contracting organization
- University of Virginia
- Cumulative value
- $120.32
About this award
The University of Virginia awarded contract A207_PO-0450065 to Eurofins Genomics LLC on June 17, 2026, for the provision of synthetic oligonucleotide sequences. The contract encompasses four distinct phosphorylated DNA oligonucleotide products, each specified with unique genetic sequences in the 25-base, salt-free format. All line items are designated for delivery to Edward Perez-Reyes and priced at $30.08 per unit, with a single quantity ordered for each product.
The cumulative contract value is $120.32, reflecting the procurement of four specialized genomic reagents. These oligonucleotides, designated as T77U, T77L, T80U, and T80L variants, represent research-grade molecular biology materials likely intended for molecular research applications at the University of Virginia. The contract award is classified under Virginia (VA) jurisdiction, with Eurofins Genomics LLC serving as the prime contractor responsible for fulfillment of all specified deliverables.
Line items
| Item | Total |
|---|---|
| T77U-[PHO]GCGACACCACAGCCACAATGAGGAACTGTGAAGCCACAGATGGGTTCCTCATTGTGGCTGTGGT ( 25S,SaltFree) | $30.08 |
| T77L-[PHO]GCAGACCACAGCCACAATGAGGAACCCATCTGTGGCTTCACAGTTCCTCATTGTGGCTGTGGTG ( 25S,SaltFree) | $30.08 |
| T80U-[PHO]GCGACACCACCACAGCCACAATGAGCTGTGAAGCCACAGATGGGCTCATTGTGGCTGTGGTGGT ( 25S,SaltFree) | $30.08 |
| T80L-[PHO]GCAGACCACCACAGCCACAATGAGCCCATCTGTGGCTTCACAGCTCATTGTGGCTGTGGTGGTG ( 25S,SaltFree) | $30.08 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0450065?
Contract A207_PO-0450065 was awarded to Eurofins Genomics LLC by University of Virginia on June 17, 2026.
How much is contract A207_PO-0450065 worth?
Its cumulative value is $120.32.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award