oJDW 2628, ConfigurationID: 5409082 Product Number: VC00021 Product Description: DNA Oligos in Tubes…
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0449877
- Awardee
- Sigma-Aldrich Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $8.82
About this award
The University of Virginia awarded contract A207_PO-0449877 to Sigma-Aldrich Inc on June 17, 2026, for the procurement of specialized molecular biology products. The contract, valued at eight dollars ($8.00), represents a single-line-item purchase delivered to the Commonwealth of Virginia. The awarded product consists of DNA oligonucleotides (DNA Oligos) supplied in tube format, specifically designated as oJDW 2628 with Configuration ID 5409082 and Product Number VC00021.
The DNA oligo product specifications include a 49 base-pair sequence (GGGGACCCAGCTTTCTTGTACAAAGTGGCTAGAGGAATTCCGCCCCTCT) at a scale of 0.0250 micromoles, processed through desalt purification methodology, and packaged in a single tube for ambient shipping conditions. Delivery was directed to Athira Pillai at the University of Virginia. The unit price was $8.82 for the single unit ordered, with the contract cumulative value totaling eight dollars.
Line items
| Item | Total |
|---|---|
| oJDW 2628, ConfigurationID: 5409082 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 49 shipping: Ambient sequence: GGGGACCCAGCTTTCTTGTACAAAGTGGCTAGAGGAATTCCGCCCCTCT scale: 0.0250 UMO name: oJDW 2628 purification: DESALT tubes | $8.82 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0449877?
Contract A207_PO-0449877 was awarded to Sigma-Aldrich Inc by University of Virginia on June 17, 2026.
How much is contract A207_PO-0449877 worth?
Its cumulative value is $8.82.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award