Name:eEF1-80-longlinker…
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0448803
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Cumulative value
- $85.50
About this award
The University of Virginia awarded contract A207_PO-0448803 to Integrated DNA Technologies Inc. on June 13, 2026, for the delivery of a specialized molecular biology product. The contract involves the supply of a single eEF1-80-longlinker DNA sequence construct, a synthetic oligonucleotide with a specific genetic sequence designed for molecular cloning applications. The line item is to be delivered to Yelena Peskova at the University of Virginia in Virginia. The total contract value is $85.00.
The deliverable under this purchase order consists of one unit of the specified DNA sequence product at a unit price of $85.50. This contract represents a straightforward procurement of research-grade molecular biology materials by an academic institution from a specialized supplier. No information regarding the overall contract performance period or place of performance beyond the delivery location is available from the documentation provided.
Line items
| Item | Total |
|---|---|
| Name:eEF1-80-longlinker Sequence:ACGTTGTAAAACGACGGCCAGTGAATTGACGCGTATTGGGATATCCCAATTGCGCGCCTAATACGACTCACTATAGGCCGCCACCATGGATTACAAGGACCATGATGGAGATTACAAAGACCATGACATTGATTATAAGGACGATGATGACAAGTCCAAGGAGCCGCTTCGGCCACGGTGCCGCCCCATCAACGCCACCCTGGCTGTGGAGAAGGAGG | $85.50 |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0448803?
Contract A207_PO-0448803 was awarded to Integrated DNA Technologies Inc by University of Virginia on June 13, 2026.
How much is contract A207_PO-0448803 worth?
Its cumulative value is $85.50.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award