Name:ZBP1_fl_F2 Sequence:GGG TGG AAT TGG AGT TAT AGA TAG Product:25 nmole DNA Oligo… and 1 more item

The University of Virginia awarded a contract to Integrated DNA Technologies Inc. on July 11, 2026, for the supply of custom DNA oligonucleotides. The contract, identified as A207_PO-0446906, is valued at nine dollars and represents a purchase order from the Virginia-based educational institution. The prime contractor will deliver specialized molecular biology reagents to the buyer as specified in the purchase order terms.

The deliverables consist of two distinct DNA oligo products, each ordered in a quantity of four units. The first line item is ZBP1_fl_F2, a 25 nanomole DNA oligonucleotide with a 24-base sequence (GGGTGGAATTGGAGTTATAGAT AG) requiring standard desalting purification. The second line item is ZBP1_fl_R2, a 25 nanomole DNA oligonucleotide with a 23-base sequence (GGGTCACCTTCTTCCAATAGCTG) also requiring standard desalting purification. Both products are priced at one dollar per unit and will be delivered directly to the buyer. These oligonucleotide primers are commonly used in molecular research applications such as polymerase chain reaction protocols and DNA sequencing.