Contract A207_PO-0442975-V3

The University of Virginia, a state institution in Virginia, awarded contract A207_PO-0442975-V3 to Eurofins Genomics LLC on August 8, 2026, with a total contract value of $7.00. The contract encompasses the procurement of specialized molecular biology reagents consisting of two distinct plasmid-based preamplifcation DNA sequences, each ordered in a quantity of three units at $1.00 per unit.

The line items specified under this purchase order include pLX-preamp F1 (sequence: GGGACAGCAGAGATCCACTTT, 10S, salt-free formulation) and pLX-preamp R2 (sequence: GGGCCACAACTCCTCATAAA, 10S, salt-free formulation). Both items are designated for delivery to the buyer at the University of Virginia. The contract represents a transactional procurement of research-grade molecular reagents, with the specified materials to be delivered in their salt-free configuration suitable for molecular biology applications. No specific period of performance or place of performance beyond the contracting organization has been identified in the available contract documentation.