Contract A207_PO-0258615-V3
State & local contract award Virginia Awarded
- Contract number
- A207_PO-0258615-V3
- Awardee
- Integrated DNA Technologies Inc
- Contracting organization
- University of Virginia
- Contract amount
- Not on record
About this award
Integrated DNA Technologies Inc has been awarded contract A207_PO-0258615-V3 by the University of Virginia on September 19, 2026. The prime contractor will deliver oligonucleotide sequences designated as KB-Miner1, with the specific nucleotide sequence detailed in the line item specifications. The contract is issued under Virginia state procurement procedures, with delivery required to the buyer as specified by the contracting organization.
The line item specification indicates a unit of measure of "Each" with a unit price of 1, though specific contract valuation, cumulative value, and period of performance details are not populated in the award documentation provided. Additional contract performance metrics, including annual value, total contract amount, and specific performance locations beyond the University of Virginia as contracting organization, are not available in the source material.
Line items
| Item | Total |
|---|---|
| Name:KB-Miner1 Sequence:GTGCGCCCGTTTCTGCCGAAAAAAAAACAGCAGAAAGATAGCCTGATTAACCTGAAAATTCAGAAAGAAAACCCGAAAGTGGTGAACGAAATTAACATTGAAGATCTGTGCCTGACCAAAGCGGCGTGCCGCTGCTGGCGCAGCAAAACCTTTCCGGCGTGCGATGGCAGCCATAACAAACATAACGAACTGACCGGCGATAACGTGGGCCCGCTGATTCTGAAAAA | — |
Award details come from logi.cgieva.com. Updated .
Quick answers
Who was awarded contract A207_PO-0258615-V3?
Contract A207_PO-0258615-V3 was awarded to Integrated DNA Technologies Inc by University of Virginia on September 19, 2026.
On GovTribe
See this award's full record
- Every line item and file
- The contract it was ordered under and its other orders
- Similar state and local awards and opportunities
- Ask GovTribe AI about this award