FY26_SOW_Next_Gen_Sequencing_Final.pdf
PDF 167 KB Posted
- Attached to
- NEFSC DNA Next Generation Sequencing Federal contract opportunity
- Solicitation number
- 1305M326Q0325
About this file
This Statement of Work describes molecular sequencing services for the National Oceanic and Atmospheric Administration (NOAA), National Marine Fisheries Service (NMFS), Northeast Fisheries Science Center (NEFSC) located in Milford, Connecticut. The contractor shall provide next-generation DNA sequencing and Sanger sequencing services for fisheries and aquaculture research projects, including work related to the Bottom Trawl Survey and Southern New England Wind Mitigation efforts.
The base year (August 1, 2026 through July 31, 2027) requires two tasks: Task 1 involves processing 300 genomic DNA samples through library preparation and MiSeq 2x150 sequencing using Illumina Nextera adapters, with results delivered in FASTQ format within six weeks of sample arrival. Task 2 requires processing 200 DNA samples through Sanger sequencing, providing chromatogram (.ab1 files) and flat text sequence files (.fa files) within the same timeframe. Option Years 1–4 (August 1, 2027 through July 31, 2031) replicate Task 1 with 350 samples per year and Task 2 with 200 samples per year. The contractor must possess current Illumina sequencing platform expertise, perform all quality control functions, and deliver results electronically no later than August 31 of each performance period. All contractor employees and subcontractors must be U.S. citizens or authorized to work in the United States. The Technical Point of Contact is Christopher Powers (christopher.powers@noaa.gov), and the Contracting Officer retains exclusive authority to modify scope and contract value.
View the file
Other files for this federal contract opportunity
| File | Type | Posted |
|---|---|---|
| Sol_1305M326Q0325_Amd_0001.pdf | ||
| Sol_1305M326Q0325.pdf | ||
| DNA_Sequencing_Pricing_Schedule.xlsx | XLSX spreadsheet | |
| Past_Performance_Questionnaire_Solicitation_1305M326Q0325.pdf |
On GovTribe
Work with this file on GovTribe
- Download the original file
- Contacts named in this file
- Similar government files
- Ask GovTribe AI about this file
Text version
STATEMENT OF WORK
NEFSC DNA Next Generation Sequencing
1. Background. The National Oceanic and Atmospheric Administration (NOAA), National Marine Fisheries Service (NMFS), Northeast Fisheries Science Center (NEFSC) lead efforts to use contemporary molecular techniques in fisheries and aquaculture research projects. These efforts entail long term sampling of fisheries-related projects and that require several repeated sequencing events over a longer time period in coordination with the Bottom Trawl Survey and Southern New England Wind Mitigation efforts. These samples will be provided as amplified DNA with standard metabarcoding workflows and Nextera adapters resulting in a mixed population of amplicons. Additional projects also require a blend of next generation sequencing, using similar metabarcoding workflows described above, and sanger sequencing for continued gut content analysis for the identification of manually isolated prey items. When it comes to next generation sequencing, we would need to rely on a creditable service provider that owns the most up-to-date Illumina sequencing platforms and chemistry, as well as the required expertise to perform these tasks.
2. General Requirements (see section 8. Specific Tasks)
2.1. Scope of Work. Non-Personal Service. Contractor shall provide all trained labor, equipment, materials, supervision, transportation, permits, insurance, and quality control necessary to provide molecular extraction of fixed tissue samples, library preparation, and Next-Generation Sequencing of prepared pooled library for low coverage Whole Genome Sequencing for the NMFS/NEFSC (Milford Lab).
Performance under this contract known as “Work”. Contractor shall be fully knowledgeable of all contract requirements and shall ensure Work is accomplished in accordance with the terms and conditions of the contract in a manner that will promote and maintain a safe environment.
We require two tasks in the base year including library preparation and sequencing services to accommodate a variable number of DNA samplers sent to the vendor (Base year requires Task 1 - library preparation, and Next-Gen sequencing and Task 2 - Sanger sequencing):
Base Year: Task 1: The vendor shall process 300 genomic DNA samples by conducting library preparation and MiSeq sequencing. DNA sequences will be provided to the vendor as first-round PCR-product with locus specific primers and Illumina Nextera adapter sequences (Forward adapter:
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, Reverse adapter:
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG). The vendor will conduct standard pre-sequencing workflows from the first-round PCR, including first-round PCR cleanup, ligation of indices, secondary-round PCR cleanup, amplicon library preparation, QC steps (e.g. BioAnalyzer or Tapestation), equimolar pooling for multiplexing. Resulting libraries will be sequenced on an illumina platform (e.g. MiSeq 1x150). Results will be provided to NEFSC project leads in FASTQ format through a standardized distribution method (e.g. Illumina BaseSpace or an SFTP server).
Base Year: Task 2: The vendor shall process 200 DNA samples by conducting sanger sequencing of amplified PCR products. Exact specifications will be based on vendor needs, but generally, the government lab will provide DNA as a PCR-product. Approximately 1.25 ng of DNA per 100 bases of amplicon will be provided in nuclease-free water. The vendor will conduct Sanger sequencing and provide results as a chromatogram (“.ab1” files or comparable) and a flat text file with sequences (“.fa” file or comparable).
Option Years: Task 1 shall be replicated for four option years with a target of 350 samples per option year. Task 2 shall be replicated for four option years with a target of 200 samples per option year.
2.1.1. Special Qualifications and Permits. None.
2.1.2. Quality Control. Quality Control is the responsibility of the vendor.
The vendor shall provide results of quality control workflows to the government lab to ensure quality control before constructing the library.
2.2. Place of Performance: Vendor facility.
2.3. Period of Performance/Delivery: Contractor shall deliver sequences to
NEFSC within six weeks of sample arrival to vendor and no later than August 31 for each period of performance. See table below for dates.
Base Year - Task 1 & Task 2 August 1, 2026 through July 31, 2027
Option Year 1 - Task 1 August 1, 2027 through July 31, 2028
Option Year 2 - Task 1 August 1, 2028 through July 31, 2029
Option Year 3 - Task 1 August 1, 2029 through July 31, 2030
Option Year 4 - Task 1 August 1, 2030 through July 31, 2031
3. Security Requirements. Security Clearances are not required.
3.1. Contractor employees and associated subcontractors performing under this contract MUST be U.S. citizens or MUST have established and maintain legal residence in the U.S., and be authorized by the US Government to work in the United States (i.e. Green card, worker authorization, etc.).
4. Safety, Security, Fire Protection, Environmental Controls, Conservation of Utilities, and Compliance with Laws and Regulations.
4.1. Safety Requirements. Contractor shall take all necessary precautions to meet proper safety standards, and regulations of all local, state and federal codes and regulations.
4.2. Security. There are no specific security requirements for performance under this contract.
5. Government Roles.
5.1. The Contracting Officer (CO) is the only individual with the authority to authorize changes within this contract that will have an effect on the scope, and monetary values (increase or decrease) of contract.
5.2. The Technical Point of Contact (TPOC) is the individual designated by the CO at contract award to perform administrative functions on the contract. The key role of the TPOC is to monitor the performance of the contract. The TPOC will observe, document, and communicate Contractor performance to the CO.
TPOC and alternate TPOC (if applicable) will be responsible for the inspection and acceptance of performance and any deliverables under the contract. The TPOC does NOT have authority to change the terms and conditions of the contract. When in the opinion of the Contractor, the TPOC requests efforts outside the existing scope of the contract, the Contractor shall promptly notify the CO in writing. Contractor under such direction shall take no action until the CO has resolved the issue or has otherwise issued a modification to the contract. TPOC is: Christopher Powers, christopher.powers@noaa.gov
6. Government Responsibilities.
6.1. Government shall inspect the Work performed under this contract. Any corrective action required as a result of the inspection will be accomplished prior to final monthly billing. Government will document instances of deficiencies.
6.2. Contractor may be notified of deficiencies in performance in writing by the CO.
Oral deficiency notifications will be confirmed in writing by the CO.
Contractor shall take prompt corrective action upon notice of deficiency.
Prompt is defined as within 24 hours of notification.
6.3. Government Furnished Property is not applicable.
7. Contractor Responsibilities.
7.1. Contractor Furnished Property, Materials, Equipment and Services (GFP/M/E/S). Contractor shall provide all plant, trained labor, equipment, materials, supervision, transportation, permits, insurance, and quality control necessary to achieve the quality performance standards of the Work in this contract.
7.1.1. Contractor shall immediately notify the CO if discrepancies are discovered between the existing property conditions and those noted on the SOW.
7.1.2. Contractor shall notify the CO immediately when it is discovered that the deliverable schedule will not be met to work together to revise the schedule as necessary. Contractor shall communicate with the CO and revise the schedule as necessary. Contractor shall not deviate from schedule without prior approval from the CO.
7.1.3. Contractor shall be fully knowledgeable of all requirements of the contract documents and shall make themselves aware of all job site conditions that will affect their performance.
7.1.4. Contractor shall maintain and adequate workforce trained to safely and satisfactorily perform under this contract.
7.1.5. Contractor shall ensure all employees and subcontractors are fully trained and have a full understanding of the statement of work task requirements; government will not provide instruction or oversight.
7.1.6. Contractor shall ensure all Contractor employees, and all associated subcontractor(s) are experienced in the type of work involved and familiar with the specifications of this contract. Contractor is responsible for damage to any Government equipment and supplies caused by Contractor personnel.
7.1.7. Contractor shall comply with all applicable interstate, local, state, and federal codes and laws.
7.1.8. Contractor shall perform in accordance with professional industry standards.
7.1.9. Contractor shall accomplish all tasks to meet the requirements of the
SOW.
8. Specific Tasks. Contractor and subcontractors working under this contract shall be fully knowledgeable and skilled in the scientific disciplines required to successfully fulfill this requirement. Contractor shall be fully knowledgeable of all contract requirements. Contractor shall at all times ensure Work is accomplished in accordance with the terms and conditions of the contract in a safe and professional manner.
Contractor shall perform the following tasks:
A. The vendor shall process 300 genomic DNA samples in the base year and a subsequent 350 DNA samples in each option year 1 - 4. The vendor will conduct standard pre-sequencing workflows from the first-round PCR, including first-round PCR cleanup, ligation of indices, secondary-round PCR cleanup, amplicon library preparation, QC steps (e.g. BioAnalyzer or Tapestation), equimolar pooling for multiplexing. Resulting libraries will be sequenced on an illumina platform (e.g.
MiSeq 2x150). Additional required technical specifications.
● The vendor shall use 2x150 chemistry: The amplicon length, including Illumina sequencing adaptors on primers and indices sequences, is under 300bp.
● The vendor shall conduct a PCR reaction to add index sequences to the sequences. Workflows will be consistent with the Illumina Nextera adapter sequences (Forward adapter:
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, Reverse adapter:
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)
● The vendor shall conduct AmpureX bead purification (or a comparable QC step) on the received PCR product and after the second-round PCR reaction.
● The vendor shall conduct qPCR (Kapa Biosystems) before library construction, in order to ensure equal mole pooling.
● The vendor shall provide results to the government TPOC via electronic means within 1 month of receiving the samples.
● The vendor shall return results for each sequencing plate to the TPOC via electronic means.
B. The vendor shall process 200 genomic DNA samples in the base year and a subsequent 200 DNA samples in each option year 1 - 4. The vendor shall conduct standard Sanger sequencing workflows and provide results for each sequenced sample to the TPOC via electronic means.
9. Deliverables. Vendor shall provide FASTQ data electronically to the TPOC within six weeks of receiving samples.
File details come from the government source that posted it. Updated .