A19_75D301-24-Q-78083.docx

REQUEST FOR QUOTATIONS

(THIS IS NOT AN ORDER)

THIS RFQ IS X IS NOT A SMALL BUSINESS SET-ASIDE.

1. REQUEST NO.

75D301-24-Q-78083

2. DATE ISSUED

08/02/2024

3. REQUISITION/PURCHASE REQUEST NO.

000HCJCB-2024-86154

OTHER

(See Schedule)

FOB

DESTINATION

7. DELIVERY

)5a. ISSUED BY OFR - Office of Acquisition Services Chamblee Campus Building 102 4770 Buford Highway Atlanta GA 30341

6. DELIVERY BY (Date)

OR BEFORE CLOSE OF BUSINESS (Date) 08/21/24 IMPORTANT: This is a request for information, and quotations furnished are not offers. If you are unable to quote, please so indicate on this form and return it. This request does not commit the Government to pay any costs incurred in the preparation of the submission of this quotation or to contract for supplies or services. Supplies are of domestic origin unless otherwise indicated by quoter. Any representations and/or certifications attached to this Request for Quotations must be completed by the quoter.

11. SCHEDULE (Include applicable Federal, State and local taxes)

ITEM NO.

(a)

SUPPLIES/SERVICES

(b)

QUANTITY

(c)

UNIT

(d)

UNIT PRICE

(e)

AMOUNT

(f)

“See Continuation Page”

NOTE: Additional provisions and representations are are not attached.

a. NAME OF QUOTER

Subject: Bulk Oligo Production for CVV Research

Solicitation Number: 75D30124Q78083

ISSUANCE DATE: August 02, 2024

QUESTIONS DUE DATE/TIME: August 13, 2024 by 5:00 PM EDT

Response DUE Date/time: August 21, 2024 by 5:00 PM EDT

Section A – Description

This is a combined synopsis/solicitation for commercial items prepared in accordance with the format in Subpart 12.6, as supplemented with additional information included in this notice. This announcement constitutes the only solicitation; proposals are being requested and a written solicitation will not be issued.

The solicitation number for this requirement is 75D30124Q78083 and is hereby issued as a Request for Quote (RFQ). The solicitation document and incorporated provisions and clauses are those in effect through Federal Acquisition Circular FAC 2024-05 dated May 22, 2024.

The associated North American Industrial Classification System (NAICS) code for this procurement is 325414 – Biological Product (except Diagnostic) Manufacturing with a Standard Size of 1,250 employees.

This is a RFQ for the procurement of bulk oligo production for CVV research. The Government intends to award a Firm-Fixed Price (FFP) contract as a result of this solicitation that will include the terms and conditions that are set forth herein.

The provision at 52.212-1, Instructions to Offerors-Commercial, applies to this acquisition along with the addenda to the provision included in the solicitation document. FAR 52.212-2, Evaluation-Commercial Items, is not included.

Offerors shall include a completed copy of the provision at 52.212-3, Offeror Representations and Certifications-Commercial Items, with its offer or indicate if it is available online at SAM.gov. FAR 52.212-4, Contract Terms and Conditions-Commercial Items, applies to this acquisition; there are no addenda to the clause. FAR 52.212-5, Contract Terms and Conditions Required To Implement Statutes or Executive Orders-Commercial Items, applies to this acquisition and the additional FAR clauses cited in the clause that are applicable have been noted.

There are no additional contract requirement(s) or terms and conditions determined by the contracting officer to be necessary for this acquisition and consistent with customary commercial practices. No telephonic quotes will be processed. All responses must be received no later than the date stated above. Contact Jennifer Gartzke, Contract Specialist, at xuy7@cdc.gov for any questions regarding this solicitation. Questions must be submitted in writing; no telephonic questions will be entertained.

SECTION B – SUPPLIES OR SERVICES AND PRICES

Line Items

Purchase Order Total: ________________

75D301-24-Q-78083

SECTION C – STATEMENT OF WORK

Statement of Work Title: Bulk Oligo Production for CVV Research

SECTION 1 – BACKGROUND

The Centers for Disease Control and Prevention (CDC) Influenza Division (ID) is responsible for developing Candidate Vaccine Viruses (CVV) based on circulating and novel influenza strains. Candidate Vaccine Viruses are reassortant viruses that are used as the starting materials for seasonal and pandemic vaccines. To facilitate the development of the CVVs, CDC uses oligonucleotides and synthetic genes to transcribe the influenza genes to produce the CVVs.

During research on influenza CVVs, many different genes must be constructed, significantly more than is required in CVV production in most cases. The Influenza Division, therefore, requires bulk production of oligonucleotides with relaxed quality standards versus those required for actual CVV production. The sequences will still follow the natural evolution of viruses and, therefore, can still not be predicted.

SUBSECTION A – Definitions

1. 96-Well Format: This format involves the bulk production of oligos in standard biological culture plates containing wells in an 8x12 grid, leading to 96 wells per plate. It is particularly useful for high-throughput applications, such as screening experiments or other large-scale projects, as it allows for the efficient and simultaneous synthesis of many different oligonucleotides.

2. Nucleotide (nt): A nucleotide is the basic building block of nucleic acids, which are the key components of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

3. Oligonucleotides (oligos) are short DNA or RNA molecules typically consisting of fewer than 80-100 nucleotides in length, after which they can often be marketed as “ultramers.” Oligos are priced primarily based on their length in nt, followed by yield, purity, accuracy, and turnaround time.

4. Base pair (bp): A base pair is the complementary pairing of two nucleotides in a double-stranded DNA or RNA molecule. When purchasing gene products (plasmids, gene fragments, etc.) commercially, they are often priced based on the “length” or number of base pairs in sequence.

5. Turnaround time (TAT): For the proposed work, TAT is defined from when the Government sends sequences to the contractor for gene synthesis to when the constructs are received by the Government.

SECTION 2 – PURPOSE/OBJECTIVE

The overall objective is to provide the Influenza Division with bulk oligos for researching influenza CVVs.

The Vaccine Preparedness Team, from the Virology Surveillance and Diagnosis Branch within the Influenza Division of the CDC, shall be the principal scientific and technical party representing the Government’s needs, working with the contractor.

The CDC will provide specific sequences digitally for each requested genetic product of the appropriate size.

SECTION 3 – SCOPE OF WORK

The contractor shall provide the following:

(a) 96-well plates containing single-stranded DNA oligonucleotides of 15-60 nucleotides (nt) in length. The turnaround time (TAT) shall be two business day with an ordering cutoff of TBD by contractor (with the ordering date being day 0). The target scale synthesis shall be 3nmol, resuspended with an expected concentration range of 7-20uM. A total of 580,000 nucleotides shall be delivered.

SECTION 4 – TASKS TO BE PERFORMED

Synthesis of bulk oligonucleotides is required for this work. A representative sequence is provided below as “Example 96-well Plate Oligo (15-60nt),”.

Example 96-well Plate Oligo (15-60 nt):

ATTTGTTCATAAGATCGTTTGGTGCCTTGAGACGCCATAATGTTGATGTCACTCGGTGAG

Independently, and not as an agent of the Government, the contractor shall provide all necessary personnel, facilities, supplies and services (except for those to be furnished by the Government as specified elsewhere in the contract agreement) to perform the work required by this statement of work.

Task 1: Single-stranded oligonucleotides ordered in 96-well plate format, 15-60nt in length

1. To a total maximum length of 580,000 nucleotides across all oligos

2. The target yield scale shall be 3nmol

3. To be resuspended in a target concentration of 7-20uM

4. No fewer than 192 oligos (two 96 plates) will be requested with each order

SECTION 5 – GOVERNMENT-FURNISHED PROPERTY

The Government will provide genetic sequences to produce acceptable oligos.

SECTION 6 – PLACE OF PERFORMANCE AND CONTRACT SUPPORT HOURS

SUBSECTION A – PLACE OF PERFORMANCE

Work shall be conducted entirely at the contractor’s facility.

SECTION 7 – TRAVEL

No travel is authorized for this award.

SECTION 8 – DELIVERABLES/REPORTING SCHEDULE

A. Delivery Schedule

(a) CDC Subject Matter Expert (SME) will place orders for DNA oligonucleotides or fragments per the Schedule of Deliverables table below. Shipments shall be sent via overnight shipping to:

TBD

(b) All shipments under this contract shall be accompanied by packing slips that shall contain the following minimum information:

(a) Name of supplier

(b) Contract number

(c) Date of purchase

(d) Date of delivery or shipment

(e) Purchase number

(f) Itemized list of supplies, including quantity and length of each item

(g) Industry Standard Quality Assurance documentation, including sequence, yield, and purity

SECTION 9 – REFERENCE MATERIALS

None.

SECTION 10 – MINIMUM VENDOR QUALIFICATIONS

Proven capacity to produce:

1. Oligonucleotides of 15-60nt with a TAT of two business days.

SECTION 11 – ADDITIONAL REQUIREMENTS

A kickoff meeting will be scheduled virtually within 10 business days after contract award. The government attendess will include the COR, CO, and CS. Contractor shall prepare an agenda that will be sent to the COR and CO five days prior to the kickoff meeting via email. Contractor shall prepare a summary of the meeting that shall be sent via email to the COR and CO five days after meeting is held.

Information Security and Privacy The contractor (and/or any subcontractor) shall not have access to, host, and/or maintain any Government information system(s) in relation to the proposed work. All data will be provided via a secured web portal or service (e.g., Amazon Web Services or FileShare). No sensitive data, patient information, or personally identifiable information will be provided to the Contractor on the basis of the proposed work.

Section 508 Compliance Electronic and Information Technology Accessibility

(a) Section 508 of the Rehabilitation Act of 1973 (29 U.S.C. 794d), as amended by the Workforce Investment Act of 1998 and the Architectural and Transportation Barriers Compliance Board Electronic and Information (EIT) Accessibility Standards (36 CFR part 1194), require that when Federal agencies develop, procure, maintain, or use electronic and information technology, Federal employees with disabilities have access to and use of information and data that is comparable to the access and use by Federal employees who are not individuals with disabilities, unless an undue burden would be imposed on the agency. Section 508 also requires that individuals with disabilities, who are members of the public seeking information or services from a Federal agency, have access to and use of information and data that is comparable to that provided to the public who are not individuals with disabilities, unless an undue burden would be imposed on the agency.

(b) Accordingly, any offeror responding to this solicitation must comply with established HHS EIT accessibility standards. Information about Section 508 is available at http://www.hhs.gov/web/508. The complete text of the Section 508 Final Provisions can be accessed at http://www.access-aboard.gov/sec508/standards.htm.

(c) The Section 508 accessibility standards applicable to this contract are: 1194.

205 WCAG 2.0 Level A & AA Success Criteria 302 Functional Performance Criteria 502 Inoperability with Assistive Technology 504 Authoring Tools 602 Support Documentation 603 Support Services In order to facilitate the Government's determination whether proposed EIT supplies meet applicable Section 508 accessibility standards, offerors must submit an HHS Section 508 Product Assessment Template, in accordance with its completion instructions. The purpose of the template is to assist HHS acquisition and program officials in determining whether proposed EIT supplies conform to applicable Section 508 accessibility standards. The template allows offerors or developers to self-evaluate their supplies and documentation detail - whether they conform to a specific Section 508 accessibility standard, and any underway remediation efforts addressing conformance issues. Instructions for preparing the HHS Section 508 Evaluation Template are available under Section 508 policy on the HHS Web site http://hhs.gov/web/508.

In order to facilitate the Government's determination whether proposed EIT services meet applicable Section 508 accessibility standards, offerors must provide enough information to assist the Government in determining that the EIT services conform to Section 508 accessibility standards, including any underway remediation efforts addressing conformance issues.

(d) Respondents to this solicitation must identify any exception to Section 508 requirements. If a offeror claims its supplies or services meet applicable Section 508 accessibility standards, and it is later determined by the Government, i.e., after award of a contract or order, that supplies or services delivered do not conform to the accessibility standards, remediation of the supplies or services to the level of conformance specified in the contract will be the responsibility of the Contractor at its expense.

(e) Electronic content must be accessible to HHS acceptance criteria. Checklist for various formats are available at http://508.hhs.gov/, or from the Section 508 Coordinator listed at https://www.hhs.gov/web/section-508/additional-resources/section-508-contacts/index.html. Materials that are final items for delivery should be accompanied by the appropriate checklist, except upon approval of the Contracting Officer or Representative.

(End of verbiage) OTHER CONSIDERATIONS AND ADDITIONAL INFORMATION FOR OFFICE OF ACQUISITION SERVICES

SUBSECTION B – PROCUREMENT POINT OF CONTACT (POC) INFORMATION

COR/POC:

Shipping address for materials:

TBD

Contracting Officer Liubov Kriel 770.488.2856 lkriel@cdc.gov

Contract Specialist Jennifer Gartzke 404.498.0020 Xuy7@cdc.gov

SECTION D TERMS AND CONDITIONS

Clauses

Clauses Incorporated by Reference

52.204-12 Unique Entity Identifier Maintenance (OCT 2016) 52.204-13 System for Award Management Maintenance (OCT 2018) 52.204-18 Commercial and Government Entity Code Maintenance (AUG 2020) 52.204-19 Incorporation by Reference of Representations and Certifications (DEC 2014) 52.212-4 Contract Terms and Conditions—Commercial Products and Commercial Services (NOV 2023) 52.227-17 Rights in Data – Special Work (DEC 2007) 52.232-1 Payments (APR 1984) 52.232-39 Unenforceability of Unauthorized Obligations (JUN 2013) 52.233-1 Disputes (MAY 2014) 52.233-4 Applicable Law for Breach of Contract Claim (OCT 2004) 52.244-6 Subcontracts for Commercial Products and Commercial Services (FEB 2024)

HHSAR Source 352.222-70 Contractor Cooperation in Equal Employment Opportunity Investigation

Clauses Incorporated by Full Text

52.252-2 Clauses Incorporated by Reference.

As prescribed in 52.107(b), insert the following clause:

Clauses Incorporated By Reference (Feb 1998) This contract incorporates one or more clauses by reference, with the same force and effect as if they were given in full text. Upon request, the Contracting Officer will make their full text available. Also, the full text of a clause may be accessed electronically at this/these address(es):

Home | Acquisition.GOV HHSAR | Acquisition.GOV (End of clause)

FAR Clauses Incorporated by Full Text

52.204-1 Approval of Contract (DEC 1989) This contract is subject to the written approval of Liubov Kriel and shall not be binding until so approved.

(End of clause)

52.212-5 Contract Terms and Conditions Required To Implement Statutes or Executive Orders—Commercial Products and Commercial Services (MAY 2024)

(a) The Contractor shall comply with the following Federal Acquisition Regulation (FAR) clauses, which are incorporated in this contract by reference, to implement provisions of law or Executive orders applicable to acquisitions of commercial products and commercial services:

(1) 52.203-19, Prohibition on Requiring Certain Internal Confidentiality Agreements or Statements (Jan 2017) (section 743 of Division E, Title VII, of the Consolidated and Further Continuing Appropriations Act, 2015 (Pub. L. 113-235) and its successor provisions in subsequent appropriations acts (and as extended in continuing resolutions)).

(2) 52.204-23, Prohibition on Contracting for Hardware, Software, and Services Developed or Provided by Kaspersky Lab Covered Entities (Dec 2023) (Section 1634 of Pub. L. 115-91).

(3) 52.204-25, Prohibition on Contracting for Certain Telecommunications and Video Surveillance Services or Equipment. (Nov 2021) (Section 889(a)(1)(A) of Pub. L. 115-232).

(4) 52.209-10, Prohibition on Contracting with Inverted Domestic Corporations (Nov 2015).

(5) 52.232-40, Providing Accelerated Payments to Small Business Subcontractors (Mar 2023) ( 31 U.S.C. 3903 and 10 U.S.C. 3801).

(6) 52.233-3, Protest After Award (Aug 1996) ( 31 U.S.C. 3553).

(7) 52.233-4, Applicable Law for Breach of Contract Claim (Oct 2004) (Public Laws 108-77 and 108-78 ( 19 U.S.C. 3805 note)).

(b) The Contractor shall comply with the FAR clauses in this paragraph (b) that the Contracting Officer has indicated as being incorporated in this contract by reference to implement provisions of law or Executive orders applicable to acquisitions of commercial products and commercial services:

[Contracting Officer check as appropriate.]

__ (1) 52.203-6, Restrictions on Subcontractor Sales to the Government (Jun 2020), with Alternate I (Nov 2021) ( 41 U.S.C. 4704 and 10 U.S.C. 4655).

__ (2) 52.203-13, Contractor Code of Business Ethics and Conduct (Nov 2021) ( 41 U.S.C. 3509)).

__ (3) 52.203-15, Whistleblower Protections under the American Recovery and Reinvestment Act of 2009 (Jun 2010) (Section 1553 of Pub. L. 111-5). (Applies to contracts funded by the American Recovery and Reinvestment Act of 2009.)

_X_ (4) 52.203-17, Contractor Employee Whistleblower Rights (Nov 2023) ( 41 U.S.C. 4712); this clause does not apply to contracts of DoD, NASA, the Coast Guard, or applicable elements of the intelligence community—see FAR 3.900(a).

_X_ (5) 52.204-10, Reporting Executive Compensation and First-Tier Subcontract Awards (Jun 2020) (Pub. L. 109-282) ( 31 U.S.C. 6101 note).

__ (6) [Reserved].

__ (7) 52.204-14, Service Contract Reporting Requirements (Oct 2016) (Pub. L. 111-117, section 743 of Div. C).

__ (8) 52.204-15, Service Contract Reporting Requirements for Indefinite-Delivery Contracts (Oct 2016) (Pub. L. 111-117, section 743 of Div. C).

_X_ (9) 52.204-27, Prohibition on a ByteDance Covered Application (Jun 2023) (Section 102 of Division R of Pub. L. 117-328).

__ (10) 52.204-28, Federal Acquisition Supply Chain Security Act Orders—Federal Supply Schedules, Governmentwide Acquisition Contracts, and Multi-Agency Contracts. (Dec 2023) ( Pub. L. 115–390, title II).

_X_ (11) (i) 52.204-30, Federal Acquisition Supply Chain Security Act Orders—Prohibition. (Dec 2023) ( Pub. L. 115–390, title II).

__ (ii) Alternate I (Dec 2023) of 52.204-30.

_X_ (12) 52.209-6, Protecting the Government’s Interest When Subcontracting with Contractors Debarred, Suspended, or Proposed for Debarment. (Nov 2021) ( 31 U.S.C. 6101 note).

__ (13) 52.209-9, Updates of Publicly Available Information Regarding Responsibility Matters (Oct 2018) ( 41 U.S.C. 2313).

__ (14) [Reserved].

__ (15) 52.219-3, Notice of HUBZone Set-Aside or Sole-Source Award (Oct 2022) ( 15 U.S.C. 657a).

__ (16) 52.219-4, Notice of Price Evaluation Preference for HUBZone Small Business Concerns (Oct 2022) (if the offeror elects to waive the preference, it shall so indicate in its offer) ( 15 U.S.C. 657a).

__ (17) [Reserved] __ (18) (i) 52.219-6, Notice of Total Small Business Set-Aside (Nov 2020) ( 15 U.S.C. 644).

__ (ii) Alternate I (Mar 2020) of 52.219-6.

__ (19) (i) 52.219-7, Notice of Partial Small Business Set-Aside (Nov 2020) ( 15 U.S.C. 644).

__ (ii) Alternate I (Mar 2020) of 52.219-7.

__ (20) 52.219-8, Utilization of Small Business Concerns (Feb 2024) ( 15 U.S.C. 637(d)(2) and (3)).

__ (21) (i) 52.219-9, Small Business Subcontracting Plan (Sep 2023) ( 15 U.S.C. 637(d)(4)).

__ (ii) Alternate I (Nov 2016) of 52.219-9.

__ (iii) Alternate II (Nov 2016) of 52.219-9.

__ (iv) Alternate III (Jun 2020) of 52.219-9.

__ (v) Alternate IV (Sep 2023) of 52.219-9.

__ (22) (i) 52.219-13, Notice of Set-Aside of Orders (Mar 2020) ( 15 U.S.C. 644(r)).

__ (ii) Alternate I (Mar 2020) of 52.219-13.

__ (23) 52.219-14, Limitations on Subcontracting (Oct 2022) ( 15 U.S.C. 637s).

__ (24) 52.219-16, Liquidated Damages—Subcontracting Plan (Sep 2021) ( 15 U.S.C. 637(d)(4)(F)(i)).

__ (25) 52.219-27, Notice of Set-Aside for, or Sole-Source Award to, Service-Disabled Veteran-Owned Small Business (SDVOSB) Concerns Eligible Under the SDVOSB Program (Feb 2024) ( 15 U.S.C. 657f).

_X_ (26) (i) 52.219-28, Post Award Small Business Program Rerepresentation (Feb 2024) ( 15 U.S.C. 632(a)(2)).

__ (ii) Alternate I (Mar 2020) of 52.219-28.

__ (27) 52.219-29, Notice of Set-Aside for, or Sole-Source Award to, Economically Disadvantaged Women-Owned Small Business Concerns (Oct 2022) ( 15 U.S.C. 637(m)).

__ (28) 52.219-30, Notice of Set-Aside for, or Sole-Source Award to, Women-Owned Small Business Concerns Eligible Under the Women-Owned Small Business Program (Oct 2022) ( 15 U.S.C. 637(m)).

__ (29) 52.219-32, Orders Issued Directly Under Small Business Reserves (Mar 2020) ( 15 U.S.C. 644(r)).

__ (30) 52.219-33, Nonmanufacturer Rule (Sep 2021) ( 15U.S.C. 637(a)(17)).

_X_ (31) 52.222-3, Convict Labor (Jun 2003) (E.O.11755).

_X_ (32) 52.222-19, Child Labor-Cooperation with Authorities and Remedies (Feb 2024).

_X_ (33) 52.222-21, Prohibition of Segregated Facilities (Apr 2015).

_X_ (34) (i) 52.222-26, Equal Opportunity (Sep 2016) (E.O.11246).

__ (ii) Alternate I (Feb 1999) of 52.222-26.

__ (35) (i) 52.222-35, Equal Opportunity for Veterans (Jun 2020) ( 38 U.S.C. 4212).

__ (ii) Alternate I (Jul 2014) of 52.222-35.

_X_ (36) (i) 52.222-36, Equal Opportunity for Workers with Disabilities (Jun 2020) ( 29 U.S.C. 793).

__ (ii) Alternate I (Jul 2014) of 52.222-36.

_ _ (37) 52.222-37, Employment Reports on Veterans (Jun 2020) ( 38 U.S.C. 4212).

__ (38) 52.222-40, Notification of Employee Rights Under the National Labor Relations Act (Dec 2010) (E.O. 13496).

_X_ (39) (i) 52.222-50, Combating Trafficking in Persons (Nov 2021) ( 22 U.S.C. chapter 78 and E.O. 13627).

__ (ii) Alternate I (Mar 2015) of 52.222-50 ( 22 U.S.C. chapter 78 and E.O. 13627).

__ (40) 52.222-54, Employment Eligibility Verification (May 2022) (Executive Order 12989). (Not applicable to the acquisition of commercially available off-the-shelf items or certain other types of commercial products or commercial services as prescribed in FAR 22.1803.)

__ (41) (i) 52.223-9, Estimate of Percentage of Recovered Material Content for EPA–Designated Items (May 2008) ( 42 U.S.C. 6962(c)(3)(A)(ii)). (Not applicable to the acquisition of commercially available off-the-shelf items.)

__ (ii) Alternate I (May 2008) of 52.223-9 ( 42 U.S.C. 6962(i)(2)(C)). (Not applicable to the acquisition of commercially available off-the-shelf items.)

__ (42) 52.223-11, Ozone-Depleting Substances and High Global Warming Potential Hydrofluorocarbons (May 2024) ( 42 U.S.C. 7671, et seq.).

__ (43) 52.223-12, Maintenance, Service, Repair, or Disposal of Refrigeration Equipment and Air Conditioners (May 2024) ( 42 U.S.C. 7671, et seq.).

__ (44) 52.223-20, Aerosols (May 2024) ( 42 U.S.C. 7671, et seq.).

__ (45) 52.223-21, Foams (May 2024) ( 42 U.S.C. 7671, et seq.).

__ (46) 52.223-23, Sustainable Products and Services (May 2024) ( E.O. 14057, 7 U.S.C. 8102, 42 U.S.C. 6962, 42 U.S.C. 8259b, and 42 U.S.C. 7671l).

__ (47) (i) 52.224-3 Privacy Training (Jan 2017) (5 U.S.C. 552 a).

__ (ii) Alternate I (Jan 2017) of 52.224-3.

_X_ (48) (i) 52.225-1, Buy American-Supplies (Oct 2022) ( 41 U.S.C. chapter 83).

__ (ii) Alternate I (Oct 2022) of 52.225-1.

_ _ (49) (i) 52.225-3, Buy American-Free Trade Agreements-Israeli Trade Act (NOV 2023) ( 19 U.S.C. 3301 note, 19 U.S.C. 2112 note, 19 U.S.C. 3805 note, 19 U.S.C. 4001 note, 19 U.S.C. chapter 29 (sections 4501-4732), Public Law 103-182, 108-77, 108-78, 108-286, 108-302, 109-53, 109-169, 109-283, 110-138, 112-41, 112-42, and 112-43.

__ (ii) Alternate I [Reserved].

_ _ (iii) Alternate II (Dec 2022) of 52.225-3.

__ (iv) Alternate III (Feb 2024) of 52.225-3.

__ (v) Alternate IV (Oct 2022) of 52.225-3.

__ (50) 52.225-5, Trade Agreements (NOV 2023) ( 19 U.S.C. 2501, et seq., 19 U.S.C. 3301 note).

__ (51) 52.225-13, Restrictions on Certain Foreign Purchases (Feb 2021) (E.O.’s, proclamations, and statutes administered by the Office of Foreign Assets Control of the Department of the Treasury).

__ (52) 52.225-26, Contractors Performing Private Security Functions Outside the United States (Oct 2016) (Section 862, as amended, of the National Defense Authorization Act for Fiscal Year 2008; 10 U.S.C. Subtitle A, Part V, Subpart G Note).

__ (53) 52.226-4, Notice of Disaster or Emergency Area Set-Aside (Nov 2007) ( 42 U.S.C. 5150).

__ (54) 52.226-5, Restrictions on Subcontracting Outside Disaster or Emergency Area (Nov 2007) ( 42 U.S.C. 5150).

_X_ (55) 52.226-8, Encouraging Contractor Policies to Ban Text Messaging While Driving (May 2024) ( E.O. 13513).

__ (56) 52.229-12, Tax on Certain Foreign Procurements (Feb 2021).

__ (57) 52.232-29, Terms for Financing of Purchases of Commercial Products and Commercial Services (Nov 2021) ( 41 U.S.C. 4505, 10 U.S.C. 3805).

__ (58) 52.232-30, Installment Payments for Commercial Products and Commercial Services (Nov 2021) ( 41 U.S.C. 4505, 10 U.S.C. 3805).

_X_ (59) 52.232-33, Payment by Electronic Funds Transfer-System for Award Management (Oct2018) ( 31 U.S.C. 3332).

__ (60) 52.232-34, Payment by Electronic Funds Transfer-Other than System for Award Management (Jul 2013) ( 31 U.S.C. 3332).

__ (61) 52.232-36, Payment by Third Party (May 2014) ( 31 U.S.C. 3332).

__ (62) 52.239-1, Privacy or Security Safeguards (Aug 1996) ( 5 U.S.C. 552a).

__ (63) 52.242-5, Payments to Small Business Subcontractors (Jan 2017) ( 15 U.S.C. 637(d)(13)).

__ (64) (i) 52.247-64, Preference for Privately Owned U.S.-Flag Commercial Vessels (Nov 2021) ( 46 U.S.C. 55305 and 10 U.S.C. 2631).

__ (ii) Alternate I (Apr 2003) of 52.247-64.

__ (iii) Alternate II (Nov 2021) of 52.247-64.

(c) The Contractor shall comply with the FAR clauses in this paragraph (c), applicable to commercial services, that the Contracting Officer has indicated as being incorporated in this contract by reference to implement provisions of law or Executive orders applicable to acquisitions of commercial products and commercial services:

[Contracting Officer check as appropriate.] __ (1) 52.222-41, Service Contract Labor Standards (Aug 2018) ( 41 U.S.C. chapter67).

__ (2) 52.222-42, Statement of Equivalent Rates for Federal Hires (May 2014) ( 29 U.S.C. 206 and 41 U.S.C. chapter 67).

__ (3) 52.222-43, Fair Labor Standards Act and Service Contract Labor Standards-Price Adjustment (Multiple Year and Option Contracts) (Aug 2018) ( 29 U.S.C. 206 and 41 U.S.C. chapter 67).

__ (4) 52.222-44, Fair Labor Standards Act and Service Contract Labor Standards-Price Adjustment (May 2014) ( 29U.S.C.206 and 41 U.S.C. chapter 67).

__ (5) 52.222-51, Exemption from Application of the Service Contract Labor Standards to Contracts for Maintenance, Calibration, or Repair of Certain Equipment-Requirements (May 2014) ( 41 U.S.C. chapter 67).

__ (6) 52.222-53, Exemption from Application of the Service Contract Labor Standards to Contracts for Certain Services-Requirements (May 2014) ( 41 U.S.C. chapter 67).

__ (7) 52.222-55, Minimum Wages for Contractor Workers Under Executive Order 14026 (Jan 2022).

__ (8) 52.222-62, Paid Sick Leave Under Executive Order 13706 (Jan 2022) (E.O. 13706).

__ (9) 52.226-6, Promoting Excess Food Donation to Nonprofit Organizations (Jun 2020) ( 42 U.S.C. 1792).

(d) Comptroller General Examination of Record. The Contractor shall comply with the provisions of this paragraph (d) if this contract was awarded using other than sealed bid, is in excess of the simplified acquisition threshold, as defined in FAR 2.101, on the date of award of this contract, and does not contain the clause at 52.215-2, Audit and Records-Negotiation.

(1) The Comptroller General of the United States, or an authorized representative of the Comptroller General, shall have access to and right to examine any of the Contractor’s directly pertinent records involving transactions related to this contract.

(2) The Contractor shall make available at its offices at all reasonable times the records, materials, and other evidence for examination, audit, or reproduction, until 3 years after final payment under this contract or for any shorter period specified in FAR subpart 4.7, Contractor Records Retention, of the other clauses of this contract. If this contract is completely or partially terminated, the records relating to the work terminated shall be made available for 3 years after any resulting final termination settlement. Records relating to appeals under the disputes clause or to litigation or the settlement of claims arising under or relating to this contract shall be made available until such appeals, litigation, or claims are finally resolved.

(3) As used in this clause, records include books, documents, accounting procedures and practices, and other data, regardless of type and regardless of form. This does not require the Contractor to create or maintain any record that the Contractor does not maintain in the ordinary course of business or pursuant to a provision of law.

(e)

(1) Notwithstanding the requirements of the clauses in paragraphs (a), (b), (c), and (d) of this clause, the Contractor is not required to flow down any FAR clause, other than those in this paragraph (e)(1), in a subcontract for commercial products or commercial services. Unless otherwise indicated below, the extent of the flow down shall be as required by the clause-

(i) 52.203-13, Contractor Code of Business Ethics and Conduct (Nov 2021) ( 41 U.S.C. 3509).

(ii) 52.203-17, Contractor Employee Whistleblower Rights (Nov 2023) ( 41 U.S.C. 4712).

(iii) 52.203-19, Prohibition on Requiring Certain Internal Confidentiality Agreements or Statements (Jan 2017) (section 743 of Division E, Title VII, of the Consolidated and Further Continuing Appropriations Act, 2015 (Pub. L. 113-235) and its successor provisions in subsequent appropriations acts (and as extended in continuing resolutions)).

(iv) 52.204-23, Prohibition on Contracting for Hardware, Software, and Services Developed or Provided by Kaspersky Lab Covered Entities (Dec 2023) (Section 1634 of Pub. L. 115-91).

(v) 52.204-25, Prohibition on Contracting for Certain Telecommunications and Video Surveillance Services or Equipment. (Nov 2021) (Section 889(a)(1)(A) of Pub. L. 115-232).

(vi) 52.204-27, Prohibition on a ByteDance Covered Application (Jun 2023) (Section 102 of Division R of Pub. L. 117-328).

(vii)

(A) 52.204–30, Federal Acquisition Supply Chain Security Act Orders—Prohibition. (Dec 2023) ( Pub. L. 115–390, title II).

(B) Alternate I (Dec 2023) of 52.204–30.

(viii) 52.219-8, Utilization of Small Business Concerns (Feb 2024) ( 15 U.S.C. 637(d)(2) and (3)), in all subcontracts that offer further subcontracting opportunities. If the subcontract (except subcontracts to small business concerns) exceeds the applicable threshold specified in FAR 19.702(a) on the date of subcontract award, the subcontractor must include 52.219-8 in lower tier subcontracts that offer subcontracting opportunities.

(ix) 52.222-21, Prohibition of Segregated Facilities (Apr 2015).

(x) 52.222-26, Equal Opportunity (Sep 2015) (E.O.11246).

(xi) 52.222-35, Equal Opportunity for Veterans (Jun 2020) ( 38 U.S.C. 4212).

(xii) 52.222-36, Equal Opportunity for Workers with Disabilities (Jun 2020) ( 29 U.S.C. 793).

(xiii) 52.222-37, Employment Reports on Veterans (Jun 2020) ( 38 U.S.C. 4212).

(xiv) 52.222-40, Notification of Employee Rights Under the National Labor Relations Act (Dec 2010) (E.O. 13496). Flow down required in accordance with paragraph (f) of FAR clause 52.222-40.

(xv) 52.222-41, Service Contract Labor Standards (Aug 2018) ( 41 U.S.C. chapter 67).

(xvi)

(A) 52.222-50, Combating Trafficking in Persons (Nov 2021) ( 22 U.S.C. chapter 78 and E.O 13627).

(B) Alternate I (Mar 2015) of 52.222-50 ( 22 U.S.C. chapter 78 and E.O. 13627).

(xvii) 52.222-51, Exemption from Application of the Service Contract Labor Standards to Contracts for Maintenance, Calibration, or Repair of Certain Equipment-Requirements (May 2014) ( 41 U.S.C. chapter 67).

(xviii) 52.222-53, Exemption from Application of the Service Contract Labor Standards to Contracts for Certain Services-Requirements (May 2014) ( 41 U.S.C. chapter 67).

(xix) 52.222-54, Employment Eligibility Verification (May 2022) (E.O. 12989).

(xx) 52.222-55, Minimum Wages for Contractor Workers Under Executive Order 14026 (Jan 2022).

(xxi) 52.222-62, Paid Sick Leave Under Executive Order 13706 (Jan 2022) (E.O. 13706).

(xxii)

(A) 52.224-3, Privacy Training (Jan 2017) ( 5 U.S.C. 552a).

(B) Alternate I (Jan 2017) of 52.224-3.

(xxiii) 52.225-26, Contractors Performing Private Security Functions Outside the United States (Oct 2016) (Section 862, as amended, of the National Defense Authorization Act for Fiscal Year 2008; 10 U.S.C. Subtitle A, Part V, Subpart G Note).

(xxiv) 52.226-6, Promoting Excess Food Donation to Nonprofit Organizations (Jun 2020) ( 42 U.S.C. 1792). Flow down required in accordance with paragraph (e) of FAR clause 52.226-6.

(xxv) 52.232-40, Providing Accelerated Payments to Small Business Subcontractors (Mar 2023) ( 31 U.S.C. 3903 and 10 U.S.C. 3801). Flow down required in accordance with paragraph (c) of 52.232-40.

(xxvi) 52.247-64, Preference for Privately Owned U.S.-Flag Commercial Vessels (Nov 2021) ( 46 U.S.C. 55305 and 10 U.S.C. 2631). Flow down required in accordance with paragraph (d) of FAR clause 52.247-64.

(2) While not required, the Contractor may include in its subcontracts for commercial products and commercial services a minimal number of additional clauses necessary to satisfy its contractual obligations.

(End of clause)

CDC Terms and Conditions

CDC0_G008 Contracting Officer’s Representative (COR) (Jul 2017) Performance of the work hereunder shall be subject to the technical directions of the designated COR for this contract.

As used herein, technical directions are directions to the Contractor which fill in details, suggests possible lines of inquiry, or otherwise completes the general scope of work set forth herein. These technical directions must be within the general scope of work and may not alter the scope of work or cause changes of such a nature as to justify an adjustment in the stated contract price/cost, or any stated limitation thereof.

In the event that the Contractor believes full implementation of any of these directions may exceed the scope of the contract, he or she shall notify the originator of the technical direction and the Contracting Officer, immediately or as soon as possible, in a letter or e-mail separate of any required report(s). No technical direction, nor its fulfillment, shall alter or abrogate the rights and obligations fixed in this contract.

The Government COR is not authorized to change any of the terms and conditions of this contract. Contract changes shall be made only by the Contracting Officer by properly written modification(s) to the contract.

The Government will provide the Contractor with a copy of the COR delegation memorandum upon request.

CDCP_G009 Contracting Officer (Jul 1999)

(a) The Contracting Officer is the only individual who can legally commit the Government to the expenditure of public funds. No person other than the Contracting Officer can make any changes to the terms, conditions, general provisions, or other stipulations of this contract.

(b) No information, other than that which may be contained in an authorized modification to this contract, duly issued by the Contracting Officer, which may be received from any person employed by the United States Government, or otherwise, shall be considered grounds for deviation from any stipulation of this contract.

CDC0_G018 Payment by Electronic Funds Transfer (Feb 2018)-Clause will remain as is based off guidance from Commercial Payment Branch. It will continue to be included in all contracts.

The Centers for Disease Control and Prevention Office of Financial Resources (OFR) P.O. Box 15580 Atlanta, GA 30333 Or – Fax copy to: 404-638-5342

CDCA_H005 Data Subject to Privacy Act Requirements (Jul 2017)

(a) Notification is hereby given that the Contractor and its employees are subject to criminal penalties for violation of the Privacy Act to the same extent as employees of the Government. The Contractor shall assure that each of its employees knows the prescribed rules of conduct and that each is aware that he or she can be subjected to criminal penalty for violation of the Act.

(b) In accordance with HHSAR Clause 352.224-70, Privacy Act, which has been incorporated into this contract, certain data provided to the Contractor under this contract shall be treated confidentially. The type(s) of data subject to this clause are as follows:

(c) Following are the requirements for handling this data and the disposition to be made of this data upon completion of contract performance:

(d) The Contracting Officer’s Representative (COR) is hereby designated as the official who is responsible for monitoring contractor compliance with the Privacy Act.:

CDCA_H042 Records Management Obligations (Jun 2020) A. Applicability The following applies to all Contractors whose employees create, work with, or otherwise handle Federal records, as defined in Section B, regardless of the medium in which the record exists.

B. Definitions “Federal record” as defined in 44 U.S.C. § 3301, includes all recorded information, regardless of form or characteristics, made or received by a Federal agency under Federal law or in connection with the transaction of public business and preserved or appropriate for preservation by that agency or its legitimate successor as evidence of the organization, functions, policies, decisions, procedures, operations, or other activities of the United States Government or because of the informational value of data in them.

The term Federal record:

1. includes Centers for Disease Control and Prevention (CDC) records.

2. does not include personal materials.

3. applies to records created, received, or maintained by Contractors pursuant to their CDC contract.

4. may include deliverables and documentation associated with deliverables.

C. Requirements

1. Contractor shall comply with all applicable records management laws and regulations, as well as National Archives and Records Administration (NARA) records policies, including but not limited to the Federal Records Act (44 U.S.C. chs. 21, 29, 31, 33), NARA regulations at 36 CFR Chapter XII Subchapter B, and those policies associated with the safeguarding of records covered by the Privacy Act of 1974 (5 U.S.C. 552a). These policies include the preservation of all records, regardless of form or characteristics, mode of transmission, or state of completion.

2. In accordance with 36 CFR 1222.32, all data created for Government use and delivered to, or falling under the legal control of, the Government are Federal records subject to the provisions of 44 U.S.C. chapters 21, 29, 31, and 33, the Freedom of Information Act (FOIA) (5 U.S.C. 552), as amended, and the Privacy Act of 1974 (5 U.S.C. 552a), as amended and must be managed and scheduled for disposition only as permitted by statute or regulation.

3. In accordance with 36 CFR 1222.32, Contractor shall maintain all records created for Government use or created in the course of performing the contract and/or delivered to, or under the legal control of the Government and must be managed in accordance with Federal law. Electronic records and associated metadata must be accompanied by sufficient technical documentation to permit understanding and use of the records and data.

4. CDC and its contractors are responsible for preventing the alienation or unauthorized destruction of records, including all forms of mutilation. Records may not be removed from the legal custody of CDC or destroyed except for in accordance with the provisions of the agency records schedules and with the written concurrence of the Head of the Contracting Activity. Willful and unlawful destruction, damage or alienation of Federal records is subject to the fines and penalties imposed by 18 U.S.C. 2701. In the event of any unlawful or accidental removal, defacing, alteration, or destruction of records, Contractor must report to the Contracting Officer and the Contracting Officer’s Representative. The agency must report promptly to NARA in accordance with 36 CFR 1230.

5. The Contractor shall immediately notify the appropriate Contracting Officer upon discovery of any inadvertent or unauthorized disclosures of information, data, documentary materials, records or equipment. Disclosure of non-public information is limited to authorized personnel with a need-to-know as described in the contract. The Contractor shall ensure that the appropriate personnel, administrative, technical, and physical safeguards are established to ensure the security and confidentiality of this information, data, documentary material, records and/or equipment is properly protected. The Contractor shall not remove material from Government facilities or systems, or facilities or systems operated or maintained on the Government’s behalf, without the express written permission of the Head of the Contracting Activity. When information, data, documentary material, records and/or equipment is no longer required, it shall be returned to CDC control, or the Contractor must hold it until otherwise directed. Items returned to the Government shall be hand carried, mailed, emailed, or securely electronically transmitted to the Contracting Officer or address prescribed in the contract. Destruction of records is EXPRESSLY PROHIBITED unless in accordance with Paragraph (4).

6. The Contractor is required to obtain the Contracting Officer's approval prior to engaging in any contractual relationship (sub-contractor) in support of this contract requiring the disclosure of information, documentary material and/or records generated under, or relating to, contracts. The Contractor (and any sub-contractor) is required to abide by Government and CDC guidance for protecting sensitive, proprietary information, classified, and controlled unclassified information.

7. The Contractor shall only use Government IT equipment for purposes specifically tied to or authorized by the contract and in accordance with CDC policy.

8. The Contractor shall not create or maintain any records containing any non-public CDC information that are not specifically tied to or authorized by the contract.

9. The Contractor shall not retain, use, sell, or disseminate copies of any deliverable that contains information covered by the Privacy Act of 1974 or that which is generally protected from public disclosure by an exemption to the Freedom of Information Act.

10. Training. All Contractor employees assigned to this contract who create, work with, or otherwise handle records are required to take CDC-provided records management training. The Contractor is responsible for confirming training has been completed according to agency policies, including initial training and any annual or refresher training.

D. Flowdown of requirements to subcontractors

1. The Contractor shall incorporate the entire substance of the terms and conditions herein, including this paragraph, in all subcontracts under this contract, and must require written subcontractor acknowledgment of same.

2. Violation by a subcontractor of any provision set forth herein will be attributed to the Contractor.

FAR Provisions Incorporated by Reference

52.203-18 Prohibition on Contracting with Entities that Require Certain Internal Confidentiality Agreements or Statements-Representation (JAN 2017) 52.204-7 System for Award Management (AUG 2020) 52.204-16 Commercial and Government Entity Code Reporting (AUG 2020) 52.209-2 Prohibition on Contracting with Inverted Domestic Corporations-Representation (NOV 2015) 52.212-1 Instructions to Offerors Commercial Products and Commercial Services (NOV 2021) 52.225-25 Prohibition on Contracting With Entities Engaging in Certain Activities or Transactions Relating to Iran’s Representation and Certifications (JUN 2020)

FAR Provisions Incorporated by Full Text

52.201-1 Acquisition 360: Voluntary Survey (SEP 2023)

(a)All actual and potential offerors are encouraged to provide feedback on the preaward and debriefing processes, as applicable. Feedback may be provided to agencies up to 45 days after award. The feedback is anonymous, unless the participant self-identifies in the survey. Actual and potential offerors can participate in the survey by selecting the following link: https://www.acquisition.gov/360.

(b)The Contracting Officer will not review the information provided until after contract award and will not consider it in the award decision. The survey is voluntary and does not convey any protections, rights, or grounds for protest. It creates a way for actual and potential offerors to provide the Government constructive feedback about the pre-award and debriefing processes, as applicable, used for a specific acquisition.

(End of provision)

52.204-20 Predecessor of Offeror (AUG 2020)

(a) Definitions. As used in this provision– Commercial and Government Entity (CAGE) code means–

(1) An identifier assigned to entities located in the United States or its outlying areas by the Defense Logistics Agency (DLA) Commercial and Government Entity (CAGE) Branch to identify a commercial or government entity by unique location; or

(2) An identifier assigned by a member of the North Atlantic Treaty Organization (NATO) or by the NATO Support and Procurement Agency (NSPA) to entities located outside the United States and its outlying areas that the DLA Commercial and Government Entity (CAGE) Branch records and maintains in the CAGE master file. This type of code is known as a NATO CAGE (NCAGE) code.

Predecessor means an entity that is replaced by a successor and includes any predecessors of the predecessor.

Successor means an entity that has replaced a predecessor by acquiring the assets and carrying out the affairs of the predecessor under a new name (often through acquisition or merger). The term "successor" does not include new offices/divisions of the same company or a company that only changes its name. The extent of the responsibility of the successor for the liabilities of the predecessor may vary, depending on State law and specific circumstances.

(b) The Offeror represents that it □ is or □ is not a successor to a predecessor that held a Federal contract or grant within the last three years.

(c) If the Offeror has indicated "is" in paragraph (b) of this provision, enter the following information for all predecessors that…